RchiOBHm_Chr3g0490611

Ubiquitin-like protein involved in cytoplasm to vacuole transport (Cvt) and autophagic vesicle formation

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
37274555 .. 37274842
288 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 288 bp
ATGTCTACCACAAAATCTCTGACTGCTACTAAGAAAGTGGTTATTCATCTGAGAGCCACTGGTGATGCCCCTATGCTAAAGCAAGCCAAATTCAAGATACCTGTAATGGACAAGTTTGCTAAAGTGATTGACTTCTTAAGGAGGCAACTTCACCGAGATACGTTGTTTGTGTATGTCAATAGTGCATTCTCACCAAACCCAGATGAATTGGTGATGGATCTGTATAATAATTTTGGTTTTGATGGTAAACTGGTAGTCAATTATGCTTGTTCCATGGCGTGGGGCTAA

Protein Analysis

95

Amino Acids

10.77

Weight (kDa)

9.56

Isoelectric Point (pI)

32.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
APG12 PF04110 12 - 95 4.7e-33 Ubiquitin-like autophagy protein Apg12
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 279
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 1 cut(s) 225
AcsI RAATTY 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 279
AflII CTTAAG 1 cut(s) 136
AgsI TTSAA 1 cut(s) 94
AlwI GGATC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 89
AsuHPI GGTGA 4 cut(s) 74, 143, 183, 223
BccI CCATC 2 cut(s) 208, 236
BfrI CTTAAG 1 cut(s) 136
BmsI GCATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 273
Bsc4I CCNNNNNNNGG 1 cut(s) 279
Bse1I ACTGG 2 cut(s) 64, 255
BseDI CCNNGG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 279
BseMII CTCAG 1 cut(s) 41
BseNI ACTGG 2 cut(s) 64, 255
BslI CCNNNNNNNGG 1 cut(s) 279
BsmI GAATGC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 217
Bsp19I CCATGG 1 cut(s) 273
BspCNI CTCAG 1 cut(s) 42
BspPI GGATC 1 cut(s) 225
BspTI CTTAAG 1 cut(s) 136
BsrI ACTGG 2 cut(s) 64, 255
BssECI CCNNGG 1 cut(s) 273
BssMI GATC 1 cut(s) 217
BssT1I CCWWGG 1 cut(s) 273
BstAFI CTTAAG 1 cut(s) 136
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 2 cut(s) 30, 50
BstDSI CCRYGG 1 cut(s) 273
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstX2I RGATCY 1 cut(s) 217
BstYI RGATCY 1 cut(s) 217
BtgI CCRYGG 1 cut(s) 273
BtsIMutI CAGTG 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 84
CviAII CATG 1 cut(s) 274
CviJI RGCY 3 cut(s) 56, 86, 285
CviKI_1 RGCY 3 cut(s) 56, 86, 285
DdeI CTNAG 2 cut(s) 30, 50
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 273
EcoT14I CCWWGG 1 cut(s) 273
ErhI CCWWGG 1 cut(s) 273
FaeI CATG 1 cut(s) 277
FaiI YATR 5 cut(s) 74, 174, 225, 264, 275
FatI CATG 1 cut(s) 273
FblI GTMKAC 1 cut(s) 5
Hin1II CATG 1 cut(s) 277
HphI GGTGA 4 cut(s) 74, 143, 183, 223
Hpy166II GTNNAC 2 cut(s) 6, 248
Hpy188I TCNGA 2 cut(s) 21, 51
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 2 cut(s) 6, 248
HpyCH4IV ACGT 1 cut(s) 161
HpyCH4V TGCA 1 cut(s) 185
HpyF3I CTNAG 2 cut(s) 30, 50
HpySE526I ACGT 1 cut(s) 161
Hsp92II CATG 1 cut(s) 277
Kzo9I GATC 1 cut(s) 217
LpnPI CCDG 4 cut(s) 45, 114, 213, 236
LweI GCATC 1 cut(s) 55
MaeII ACGT 1 cut(s) 161
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MflI RGATCY 1 cut(s) 217
MluCI AATT 4 cut(s) 89, 206, 229, 259
MnlI CCTC 1 cut(s) 135
MseI TTAA 1 cut(s) 137
MspCI CTTAAG 1 cut(s) 136
Mva1269I GAATGC 1 cut(s) 185
NcoI CCATGG 1 cut(s) 273
NdeII GATC 1 cut(s) 217
NlaIII CATG 1 cut(s) 277
PctI GAATGC 1 cut(s) 185
PflMI CCANNNNNTGG 1 cut(s) 279
PsuI RGATCY 1 cut(s) 217
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 1 cut(s) 217
SetI ASST 2 cut(s) 103, 164
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 9 cut(s) 72, 95, 106, 113, 124, 167, 212, 263, 279
SmlI CTYRAG 1 cut(s) 136
SmoI CTYRAG 1 cut(s) 136
Sse9I AATT 4 cut(s) 89, 206, 229, 259
StyI CCWWGG 1 cut(s) 273
TaiI ACGT 1 cut(s) 164
TasI AATT 4 cut(s) 89, 206, 229, 259
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TscAI CASTG 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 35, 219
TspRI CASTG 1 cut(s) 64
Van91I CCANNNNNTGG 1 cut(s) 279
Vha464I CTTAAG 1 cut(s) 136
XapI RAATTY 1 cut(s) 89
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.