RchiOBHm_Chr3g0495401

establishment or maintenance of cytoskeleton polarity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
44920713 .. 44921112
400 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGATCGATATGATGAAGTACTTCAGAGAGGATCTACATAGGCAGCTTCTTAGTACATATTTTAAGAAGCAAGTCGATGGGCTTGAGATGCTGCAGAAGATCGAACACAACACCTCTGTTAAAGGTGCTGGAATTTCTTTATGA

Protein Analysis

47

Amino Acids

5.54

Weight (kDa)

8.11

Isoelectric Point (pI)

24.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 132
AcuI CTGAAG 1 cut(s) 7
AfaI GTAC 2 cut(s) 20, 55
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
AlwI GGATC 1 cut(s) 39
ApeKI GCWGC 2 cut(s) 43, 91
ApoI RAATTY 1 cut(s) 132
Asp700I GAANNNNTTC 1 cut(s) 20
BbvI GCAGC 2 cut(s) 55, 78
BccI CCATC 1 cut(s) 71
BfmI CTRYAG 1 cut(s) 92
BisI GCNGC 2 cut(s) 44, 92
BlsI GCNGC 2 cut(s) 45, 93
BmcAI AGTACT 1 cut(s) 20
BmsI GCATC 1 cut(s) 78
BpuEI CTTGAG 1 cut(s) 104
Bsa29I ATCGAT 1 cut(s) 6
BseCI ATCGAT 1 cut(s) 6
BseXI GCAGC 2 cut(s) 55, 78
BshVI ATCGAT 1 cut(s) 6
Bsp143I GATC 3 cut(s) 3, 31, 99
BspDI ATCGAT 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 96
BspPI GGATC 1 cut(s) 39
BssMI GATC 3 cut(s) 3, 31, 99
BstDEI CTNAG 1 cut(s) 50
BstKTI GATC 3 cut(s) 6, 34, 102
BstMBI GATC 3 cut(s) 3, 31, 99
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstSFI CTRYAG 1 cut(s) 92
BstV1I GCAGC 2 cut(s) 55, 78
BstX2I RGATCY 1 cut(s) 31
BstYI RGATCY 1 cut(s) 31
Bsu15I ATCGAT 1 cut(s) 6
BsuTUI ATCGAT 1 cut(s) 6
ClaI ATCGAT 1 cut(s) 6
Csp6I GTAC 2 cut(s) 19, 54
CviJI RGCY 2 cut(s) 46, 82
CviKI_1 RGCY 2 cut(s) 46, 82
CviQI GTAC 2 cut(s) 19, 54
DdeI CTNAG 1 cut(s) 50
DpnI GATC 3 cut(s) 5, 33, 101
DpnII GATC 3 cut(s) 3, 31, 99
Eco57I CTGAAG 1 cut(s) 7
FaiI YATR 4 cut(s) 11, 39, 58, 142
Fnu4HI GCNGC 2 cut(s) 44, 92
Fsp4HI GCNGC 2 cut(s) 44, 92
FspEI CC 7 cut(s) 14, 25, 63, 64, 108, 114, 127
GluI GCNGC 2 cut(s) 44, 92
Hpy188I TCNGA 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 50
Kzo9I GATC 3 cut(s) 3, 31, 99
LpnPI CCDG 1 cut(s) 114
Lsp1109I GCAGC 2 cut(s) 55, 78
LweI GCATC 1 cut(s) 78
MalI GATC 3 cut(s) 5, 33, 101
MboI GATC 3 cut(s) 3, 31, 99
MboII GAAGA 1 cut(s) 109
MflI RGATCY 1 cut(s) 31
MluCI AATT 1 cut(s) 132
MnlI CCTC 2 cut(s) 22, 124
MroXI GAANNNNTTC 1 cut(s) 20
MseI TTAA 2 cut(s) 63, 120
MwoI GCNNNNNNNGC 1 cut(s) 88
NdeII GATC 3 cut(s) 3, 31, 99
PdmI GAANNNNTTC 1 cut(s) 20
PkrI GCNGC 2 cut(s) 45, 93
PstI CTGCAG 1 cut(s) 96
PsuI RGATCY 1 cut(s) 31
RsaI GTAC 2 cut(s) 20, 55
RsaNI GTAC 2 cut(s) 19, 54
SaqAI TTAA 2 cut(s) 63, 120
SatI GCNGC 2 cut(s) 44, 92
Sau3AI GATC 3 cut(s) 3, 31, 99
ScaI AGTACT 1 cut(s) 20
SetI ASST 3 cut(s) 48, 116, 127
SfaNI GCATC 1 cut(s) 78
SfcI CTRYAG 1 cut(s) 92
SgeI CNNG 2 cut(s) 83, 95
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 1 cut(s) 132
TaqI TCGA 3 cut(s) 6, 75, 102
TasI AATT 1 cut(s) 132
TatI WGTACW 2 cut(s) 18, 53
Tru1I TTAA 2 cut(s) 63, 120
Tru9I TTAA 2 cut(s) 63, 120
TseI GCWGC 2 cut(s) 43, 91
TspDTI ATGAA 1 cut(s) 29
XapI RAATTY 1 cut(s) 132
XmnI GAANNNNTTC 1 cut(s) 20
ZrmI AGTACT 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.