Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0005500

Physical Location & Seq

Genomic Coordinates Reverse (-)

5546937 .. 5548469

Gene Structure 1533 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 147 bp

ATGGTATCTTCTACAAGTCTTAAATGCGATGACCTCACAGGACTGCCATTCACTTTTCCTAGAACCATAATAAGAGAAGTGGTACCGCAGCCCTATGGTGGAAGAACAATGCTCTGTCCAGCTTTGCTTTCCTGTGGAGCTGAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PITH Peptidase_M16 Peptidase_M16_C

Protein Analysis

48

Amino Acids

5.17

Weight (kDa)

6.08

Isoelectric Point (pI)

53.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005500)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G56730
fragaria_vesca	FvH4_1g06790 FvH4_1g06790 FvH4_1g06790 FvH4_1g06790 FvH4_1g06790
malus_domestica	MD15G1202300.v1.1
prunus_persica	Prupe.7G214900_v2.0.a1
pyrus_communis	pycom02g05670 pycom15g17970
rosa_chinensis	RchiOBHm_Chr2g0091871 RchiOBHm_Chr2g0091891 RchiOBHm_Chr2g0092561
rosa_laevigata	RLG00000016323
rosa_multiflora	Rmu_sc0004296.1_g000004 Rmu_sc0010910.1_g000005
rosa_roxburghii	Rroxscaffold_2G00148970
rosa_rugosa	Rorug02G0027600
rosa_samantha	Rh2AG066800 Rh2AG067000 Rh2AG073400 Rh2BG066000 Rh2BG074300 Rh2CG067400 Rh2CG075400 Rh2DG065700 Rh2DG072500
rosa_wichuraiana	Rw2G005420 Rw2G005950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	82
AccB1I	GGYRCC	1 cut(s)	82
AciI	CCGC	1 cut(s)	86
AfaI	GTAC	1 cut(s)	84
AfiI	CCNNNNNNNGG	1 cut(s)	98
AluBI	AGCT	2 cut(s)	122, 140
AluI	AGCT	2 cut(s)	122, 140
ApeKI	GCWGC	1 cut(s)	88
Asp718I	GGTACC	1 cut(s)	82
BanI	GGYRCC	1 cut(s)	82
BbvI	GCAGC	1 cut(s)	100
BfaI	CTAG	1 cut(s)	60
BisI	GCNGC	1 cut(s)	89
BlsI	GCNGC	1 cut(s)	90
BmiI	GGNNCC	1 cut(s)	84
Bsc4I	CCNNNNNNNGG	1 cut(s)	98
BseLI	CCNNNNNNNGG	1 cut(s)	98
BseXI	GCAGC	1 cut(s)	100
BshNI	GGYRCC	1 cut(s)	82
BslI	CCNNNNNNNGG	1 cut(s)	98
BspACI	CCGC	1 cut(s)	86
BspLI	GGNNCC	1 cut(s)	84
BspT107I	GGYRCC	1 cut(s)	82
BstV1I	GCAGC	1 cut(s)	100
BtgZI	GCGATG	1 cut(s)	42
Csp6I	GTAC	1 cut(s)	83
CviJI	RGCY	3 cut(s)	91, 122, 140
CviKI_1	RGCY	3 cut(s)	91, 122, 140
CviQI	GTAC	1 cut(s)	83
FaiI	YATR	2 cut(s)	68, 96
Fnu4HI	GCNGC	1 cut(s)	89
Fsp4HI	GCNGC	1 cut(s)	89
FspBI	CTAG	1 cut(s)	60
GluI	GCNGC	1 cut(s)	89
KpnI	GGTACC	1 cut(s)	86
LmnI	GCTCC	1 cut(s)	137
LpnPI	CCDG	2 cut(s)	24, 132
Lsp1109I	GCAGC	1 cut(s)	100
MaeI	CTAG	1 cut(s)	60
MboII	GAAGA	1 cut(s)	114
MnlI	CCTC	1 cut(s)	44
MseI	TTAA	1 cut(s)	21
NlaIV	GGNNCC	1 cut(s)	84
PkrI	GCNGC	1 cut(s)	90
PspN4I	GGNNCC	1 cut(s)	84
RsaI	GTAC	1 cut(s)	84
RsaNI	GTAC	1 cut(s)	83
SaqAI	TTAA	1 cut(s)	21
SatI	GCNGC	1 cut(s)	89
SetI	ASST	3 cut(s)	36, 124, 142
SgeI	CNNG	4 cut(s)	27, 51, 72, 131
SsiI	CCGC	1 cut(s)	86
SspMI	CTAG	1 cut(s)	60
Tru1I	TTAA	1 cut(s)	21
Tru9I	TTAA	1 cut(s)	21
TseI	GCWGC	1 cut(s)	88
XspI	CTAG	1 cut(s)	60

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.