RchiOBHm_Chr2g0091871

Belongs to the peptidase M16 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
5546937 .. 5548469
1533 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46704

Sequence Viewer

Length: 147 bp
ATGGTATCTTCTACAAGTCTTAAATGCGATGACCTCACAGGACTGCCATTCACTTTTCCTAGAACCATAATAAGAGAAGTGGTACCGCAGCCCTATGGTGGAAGAACAATGCTCTGTCCAGCTTTGCTTTCCTGTGGAGCTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

48

Amino Acids

5.17

Weight (kDa)

6.08

Isoelectric Point (pI)

53.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 82
AccB1I GGYRCC 1 cut(s) 82
AciI CCGC 1 cut(s) 86
AfaI GTAC 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 98
AluBI AGCT 2 cut(s) 122, 140
AluI AGCT 2 cut(s) 122, 140
ApeKI GCWGC 1 cut(s) 88
Asp718I GGTACC 1 cut(s) 82
BanI GGYRCC 1 cut(s) 82
BbvI GCAGC 1 cut(s) 100
BfaI CTAG 1 cut(s) 60
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
BmiI GGNNCC 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseLI CCNNNNNNNGG 1 cut(s) 98
BseXI GCAGC 1 cut(s) 100
BshNI GGYRCC 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 98
BspACI CCGC 1 cut(s) 86
BspLI GGNNCC 1 cut(s) 84
BspT107I GGYRCC 1 cut(s) 82
BstV1I GCAGC 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 42
Csp6I GTAC 1 cut(s) 83
CviJI RGCY 3 cut(s) 91, 122, 140
CviKI_1 RGCY 3 cut(s) 91, 122, 140
CviQI GTAC 1 cut(s) 83
FaiI YATR 2 cut(s) 68, 96
Fnu4HI GCNGC 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 89
FspBI CTAG 1 cut(s) 60
GluI GCNGC 1 cut(s) 89
KpnI GGTACC 1 cut(s) 86
LmnI GCTCC 1 cut(s) 137
LpnPI CCDG 2 cut(s) 24, 132
Lsp1109I GCAGC 1 cut(s) 100
MaeI CTAG 1 cut(s) 60
MboII GAAGA 1 cut(s) 114
MnlI CCTC 1 cut(s) 44
MseI TTAA 1 cut(s) 21
NlaIV GGNNCC 1 cut(s) 84
PkrI GCNGC 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 84
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
SaqAI TTAA 1 cut(s) 21
SatI GCNGC 1 cut(s) 89
SetI ASST 3 cut(s) 36, 124, 142
SgeI CNNG 4 cut(s) 27, 51, 72, 131
SsiI CCGC 1 cut(s) 86
SspMI CTAG 1 cut(s) 60
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TseI GCWGC 1 cut(s) 88
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.