RchiOBHm_Chr2g0124931

Cysteine-rich TM module stress tolerance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0010151
Physical Location & Seq
Forward (+)
38518545 .. 38519413
869 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGGCCAAGACGACAGAGACACAAGATAACCAACCTCCACCAGGATACCCAACTGCAACCAATGATCCCCCAACTAGGAAGAAGTTTCGGTCACGGACTAAAAAGAAAGGAGATAGGGGCTTCATTGAGGGCTGCCTATTTGCCTTGTGCTGCTGTTGGCTTTGCGAGGAATGCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CYSTM

Protein Analysis

59

Amino Acids

6.72

Weight (kDa)

8.61

Isoelectric Point (pI)

63.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CYSTM PF12734 14 - 59 2.5e-15 Cysteine-rich TM module stress tolerance
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 2 cut(s) 41, 75
AjnI CCWGG 1 cut(s) 40
Alw26I GTCTC 1 cut(s) 11
AlwI GGATC 1 cut(s) 59
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 132, 150
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 2 cut(s) 119, 137
BciT130I CCWGG 1 cut(s) 42
BciVI GTATCC 1 cut(s) 38
BcoDI GTCTC 1 cut(s) 11
BfaI CTAG 1 cut(s) 75
BfuI GTATCC 1 cut(s) 38
BisI GCNGC 2 cut(s) 133, 151
BlsI GCNGC 2 cut(s) 134, 152
Bme1390I CCNGG 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 42
Bsc4I CCNNNNNNNGG 2 cut(s) 41, 75
BseBI CCWGG 1 cut(s) 42
BseLI CCNNNNNNNGG 2 cut(s) 41, 75
BseXI GCAGC 2 cut(s) 119, 137
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 2 cut(s) 41, 75
BsmAI GTCTC 1 cut(s) 11
BsmI GAATGC 1 cut(s) 176
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 64
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 59
BssMI GATC 1 cut(s) 64
Bst2UI CCWGG 1 cut(s) 42
BstENI CCTNNNNNAGG 1 cut(s) 39
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 11
BstMBI GATC 1 cut(s) 64
BstMWI GCNNNNNNNGC 1 cut(s) 171
BstNI CCWGG 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 40
BstV1I GCAGC 2 cut(s) 119, 137
BsuI GTATCC 1 cut(s) 38
BsuRI GGCC 1 cut(s) 5
CviJI RGCY 4 cut(s) 5, 120, 132, 160
CviKI_1 RGCY 4 cut(s) 5, 120, 132, 160
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
EaeI YGGCCR 1 cut(s) 3
EcoNI CCTNNNNNAGG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 40
Fnu4HI GCNGC 2 cut(s) 133, 151
Fsp4HI GCNGC 2 cut(s) 133, 151
FspBI CTAG 1 cut(s) 75
GluI GCNGC 2 cut(s) 133, 151
HaeIII GGCC 1 cut(s) 5
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 171
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 27, 54
Lsp1109I GCAGC 2 cut(s) 119, 137
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 90
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 91
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 3 cut(s) 45, 121, 160
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 42
Mva1269I GAATGC 1 cut(s) 176
MvaI CCWGG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 171
NdeII GATC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 90
PctI GAATGC 1 cut(s) 176
PkrI GCNGC 2 cut(s) 134, 152
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
SatI GCNGC 2 cut(s) 133, 151
Sau3AI GATC 1 cut(s) 64
ScrFI CCNGG 1 cut(s) 42
SetI ASST 1 cut(s) 37
SgeI CNNG 7 cut(s) 19, 35, 53, 54, 87, 105, 157
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 40
TaqII GACCGA 1 cut(s) 78
TseFI GTSAC 1 cut(s) 90
TseI GCWGC 2 cut(s) 132, 150
Tsp45I GTSAC 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 112
TspGWI ACGGA 1 cut(s) 109
XagI CCTNNNNNAGG 1 cut(s) 39
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.