RchiOBHm_Chr2g0136161

Protein PHLOEM PROTEIN 2-LIKE A1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
53472327 .. 53473132
806 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 519 bp
ATGAGTTTTGTTGCTTTCCAATTTTTGTGCATGCAGAAAATATGGTCTGAGAAGAAATCTAGCTACAAATGCATTATGTTATATCCAAGGTGGTTCGATGTCACTTGGGGTTTTCCTCCACACTGGCTATGGAATTGTTACGAAGAAACAAGTGATGAGAACATTGAGGTAGCCAAACTAATGAGCGTATGCTGGTTAAATGTTAGAGGACAATTTAAGATGTCAGAACTCTCATCAGGAGTTGTTTATGAAATTGCATACATAGTTAAATTAACAAAGGAAGGATTTGGGTGGGAATTCCCTGTTACACTCAAACTCAAAGTGCCAGAGGGAAGAGAGCAAAAGCGTCAATACAGTCTACTTGAGAAGCCCATTGGAGAGTGGATAGAACTTATTGGTGGCAGTTTCCAGGCCAAGGAAGGGGAAACTAGAGAAGTGTCGTTTGATATTATTGAACACGGTGGACACTGGAAAAGTGGGCTTATCCTCAAAGGTATCATCATCAGGCCAAAACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

20.19

Weight (kDa)

7.66

Isoelectric Point (pI)

47.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 23 - 170 2.6e-31 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 358
AcsI RAATTY 1 cut(s) 296
AfiI CCNNNNNNNGG 2 cut(s) 415, 420
AgsI TTSAA 1 cut(s) 455
AjnI CCWGG 1 cut(s) 408
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
AoxI GGCC 2 cut(s) 411, 506
ApoI RAATTY 1 cut(s) 296
BciT130I CCWGG 1 cut(s) 410
BfaI CTAG 2 cut(s) 60, 429
Bme1390I CCNGG 1 cut(s) 410
BmrFI CCNGG 1 cut(s) 410
BpuEI CTTGAG 1 cut(s) 383
BsaJI CCNNGG 2 cut(s) 86, 414
Bsc4I CCNNNNNNNGG 2 cut(s) 415, 420
Bse1I ACTGG 2 cut(s) 128, 473
BseBI CCWGG 1 cut(s) 410
BseDI CCNNGG 2 cut(s) 86, 414
BseLI CCNNNNNNNGG 2 cut(s) 415, 420
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 2 cut(s) 128, 473
BshFI GGCC 2 cut(s) 413, 508
BslI CCNNNNNNNGG 2 cut(s) 415, 420
BsnI GGCC 2 cut(s) 413, 508
BspANI GGCC 2 cut(s) 413, 508
BspCNI CTCAG 1 cut(s) 40
BsrI ACTGG 2 cut(s) 128, 473
BssECI CCNNGG 2 cut(s) 86, 414
BssT1I CCWWGG 2 cut(s) 86, 414
Bst2UI CCWGG 1 cut(s) 410
Bst4CI ACNGT 2 cut(s) 356, 461
Bst6I CTCTTC 1 cut(s) 328
BstC8I GCNNGC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 48
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstNI CCWGG 1 cut(s) 410
BstNSI RCATGY 1 cut(s) 34
BstSCI CCNGG 1 cut(s) 408
BsuRI GGCC 2 cut(s) 413, 508
BtsIMutI CAGTG 2 cut(s) 121, 466
Cac8I GCNNGC 1 cut(s) 32
CseI GACGC 1 cut(s) 335
CviAII CATG 1 cut(s) 31
CviJI RGCY 7 cut(s) 63, 127, 173, 370, 413, 481, 508
CviKI_1 RGCY 7 cut(s) 63, 127, 173, 370, 413, 481, 508
DdeI CTNAG 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 328
EarI CTCTTC 1 cut(s) 328
Eco130I CCWWGG 2 cut(s) 86, 414
EcoRI GAATTC 1 cut(s) 296
EcoRII CCWGG 1 cut(s) 408
EcoT14I CCWWGG 2 cut(s) 86, 414
EcoT22I ATGCAT 1 cut(s) 74
ErhI CCWWGG 2 cut(s) 86, 414
FaeI CATG 1 cut(s) 34
FaiI YATR 9 cut(s) 32, 43, 77, 82, 130, 190, 249, 259, 263
FatI CATG 1 cut(s) 30
FblI GTMKAC 1 cut(s) 358
FspBI CTAG 2 cut(s) 60, 429
HaeIII GGCC 2 cut(s) 413, 508
HgaI GACGC 1 cut(s) 335
Hin1II CATG 1 cut(s) 34
Hpy166II GTNNAC 2 cut(s) 359, 464
Hpy188I TCNGA 2 cut(s) 49, 226
Hpy188III TCNNGA 1 cut(s) 237
Hpy8I GTNNAC 2 cut(s) 359, 464
HpyAV CCTTC 2 cut(s) 275, 413
HpyCH4III ACNGT 2 cut(s) 356, 461
HpyCH4V TGCA 4 cut(s) 30, 34, 72, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
HpyF3I CTNAG 1 cut(s) 48
Hsp92II CATG 1 cut(s) 34
LpnPI CCDG 9 cut(s) 109, 178, 222, 315, 339, 395, 422, 454, 490
MaeI CTAG 2 cut(s) 60, 429
MaeIII GTNAC 3 cut(s) 100, 137, 304
MboII GAAGA 3 cut(s) 64, 155, 345
MluCI AATT 6 cut(s) 20, 133, 212, 252, 269, 296
MnlI CCTC 5 cut(s) 126, 160, 200, 322, 497
Mph1103I ATGCAT 1 cut(s) 74
MseI TTAA 5 cut(s) 197, 216, 267, 272, 517
MspR9I CCNGG 1 cut(s) 410
MvaI CCWGG 1 cut(s) 410
MwoI GCNNNNNNNGC 1 cut(s) 69
NlaIII CATG 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 74
NspI RCATGY 1 cut(s) 34
PaeI GCATGC 1 cut(s) 34
Psp6I CCWGG 1 cut(s) 408
PspGI CCWGG 1 cut(s) 408
SaqAI TTAA 5 cut(s) 197, 216, 267, 272, 517
ScrFI CCNGG 1 cut(s) 410
SetI ASST 4 cut(s) 65, 92, 171, 496
SmlI CTYRAG 1 cut(s) 362
SmoI CTYRAG 1 cut(s) 362
SphI GCATGC 1 cut(s) 34
Sse9I AATT 6 cut(s) 20, 133, 212, 252, 269, 296
SspMI CTAG 2 cut(s) 60, 429
StyD4I CCNGG 1 cut(s) 408
StyI CCWWGG 2 cut(s) 86, 414
TaaI ACNGT 2 cut(s) 356, 461
TaqI TCGA 1 cut(s) 96
TasI AATT 6 cut(s) 20, 133, 212, 252, 269, 296
Tru1I TTAA 5 cut(s) 197, 216, 267, 272, 517
Tru9I TTAA 5 cut(s) 197, 216, 267, 272, 517
TscAI CASTG 2 cut(s) 128, 473
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
TspDTI ATGAA 1 cut(s) 264
TspRI CASTG 2 cut(s) 128, 473
XapI RAATTY 1 cut(s) 296
XceI RCATGY 1 cut(s) 34
XcmI CCANNNNNNNNNTGG 1 cut(s) 126
XmiI GTMKAC 1 cut(s) 358
XspI CTAG 2 cut(s) 60, 429
Zsp2I ATGCAT 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.