Rroxscaffold_2G00108430

Protein PHLOEM PROTEIN 2-LIKE A1-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
32430903 .. 32432268
1366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00108430.1

Sequence Viewer

Length: 528 bp
ATGGCAGATTCTACAAAGGGCGAGTTTCGGGAATTCAAGAAAATGAAAATATGGTCTGAGAAGAAATCTAGCTACAAATGCATTATGTTATATCCAAGGTGGTTCGATGTCACTTGGGGTTTTCCTCCACACTGGCTATGGAATTGTTACGAAGAAACAAGTGATGAGAACATTGAGGTAGCCAAACTAATGAGCGTATGCTGGTTAAATGTTAGAGGACAATTTAAGATGTCAGAACTCTCATCAGGACTTGTTTATGAAATTGCATACATAGTTAAATTAACAAAGGAAGGATTTGGATGGGAATTCCCTGTTACACTCAAACTCAAAGTGCCAGAGGGGAGAGAGCAAAAGCGTCAGTACAGTCTACTTGAGAAGCCCATTGGAGAGTGGATAGAGCTTATTGGTGGCAGTTTCCAGGCCAAGGAAGGGGAAACTAGAGAAGTGTGGTTTGATATTTATGAACACGGTGGACACTGGAAAAGTGGGCTTATCCTCAAAGGTATCATCATCAGGCCAAAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

175

Amino Acids

20.71

Weight (kDa)

8.33

Isoelectric Point (pI)

42.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 26 - 173 1.1e-30 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 367
AcsI RAATTY 2 cut(s) 32, 305
AfaI GTAC 1 cut(s) 362
AfiI CCNNNNNNNGG 2 cut(s) 424, 429
AgsI TTSAA 1 cut(s) 37
AjnI CCWGG 1 cut(s) 417
AluBI AGCT 2 cut(s) 72, 400
AluI AGCT 2 cut(s) 72, 400
AoxI GGCC 2 cut(s) 420, 515
ApoI RAATTY 2 cut(s) 32, 305
BccI CCATC 1 cut(s) 294
BciT130I CCWGG 1 cut(s) 419
BfaI CTAG 2 cut(s) 69, 438
Bme1390I CCNGG 1 cut(s) 419
BmrFI CCNGG 1 cut(s) 419
BpuEI CTTGAG 1 cut(s) 392
BsaJI CCNNGG 2 cut(s) 95, 423
Bsc4I CCNNNNNNNGG 2 cut(s) 424, 429
Bse1I ACTGG 2 cut(s) 137, 482
BseBI CCWGG 1 cut(s) 419
BseDI CCNNGG 2 cut(s) 95, 423
BseGI GGATG 1 cut(s) 305
BseLI CCNNNNNNNGG 2 cut(s) 424, 429
BseMII CTCAG 1 cut(s) 48
BseNI ACTGG 2 cut(s) 137, 482
BshFI GGCC 2 cut(s) 422, 517
BslI CCNNNNNNNGG 2 cut(s) 424, 429
BsnI GGCC 2 cut(s) 422, 517
BspANI GGCC 2 cut(s) 422, 517
BspCNI CTCAG 1 cut(s) 49
BsrI ACTGG 2 cut(s) 137, 482
BssECI CCNNGG 2 cut(s) 95, 423
BssT1I CCWWGG 2 cut(s) 95, 423
Bst2UI CCWGG 1 cut(s) 419
Bst4CI ACNGT 2 cut(s) 365, 470
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 305
BstMWI GCNNNNNNNGC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 419
BstSCI CCNGG 1 cut(s) 417
BsuRI GGCC 2 cut(s) 422, 517
BtsCI GGATG 1 cut(s) 305
BtsIMutI CAGTG 2 cut(s) 130, 475
CseI GACGC 1 cut(s) 344
Csp6I GTAC 1 cut(s) 361
CviJI RGCY 8 cut(s) 72, 136, 182, 379, 400, 422, 490, 517
CviKI_1 RGCY 8 cut(s) 72, 136, 182, 379, 400, 422, 490, 517
CviQI GTAC 1 cut(s) 361
DdeI CTNAG 1 cut(s) 57
Eco130I CCWWGG 2 cut(s) 95, 423
EcoRI GAATTC 2 cut(s) 32, 305
EcoRII CCWGG 1 cut(s) 417
EcoT14I CCWWGG 2 cut(s) 95, 423
EcoT22I ATGCAT 1 cut(s) 83
ErhI CCWWGG 2 cut(s) 95, 423
FaiI YATR 9 cut(s) 52, 86, 91, 139, 199, 258, 268, 272, 462
FblI GTMKAC 1 cut(s) 367
FokI GGATG 1 cut(s) 312
FspBI CTAG 2 cut(s) 69, 438
HaeIII GGCC 2 cut(s) 422, 517
HgaI GACGC 1 cut(s) 344
HinfI GANTC 1 cut(s) 8
Hpy166II GTNNAC 2 cut(s) 368, 473
Hpy188I TCNGA 2 cut(s) 58, 235
Hpy188III TCNNGA 3 cut(s) 29, 37, 246
Hpy8I GTNNAC 2 cut(s) 368, 473
HpyAV CCTTC 2 cut(s) 284, 422
HpyCH4III ACNGT 2 cut(s) 365, 470
HpyCH4V TGCA 2 cut(s) 81, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
HpyF3I CTNAG 1 cut(s) 57
LpnPI CCDG 9 cut(s) 118, 187, 231, 324, 348, 404, 431, 463, 499
MaeI CTAG 2 cut(s) 69, 438
MaeIII GTNAC 3 cut(s) 109, 146, 313
MboII GAAGA 2 cut(s) 73, 164
MluCI AATT 6 cut(s) 32, 142, 221, 261, 278, 305
MnlI CCTC 5 cut(s) 135, 169, 209, 331, 506
Mph1103I ATGCAT 1 cut(s) 83
MseI TTAA 4 cut(s) 206, 225, 276, 281
MspR9I CCNGG 1 cut(s) 419
MvaI CCWGG 1 cut(s) 419
MwoI GCNNNNNNNGC 1 cut(s) 78
NmuCI GTSAC 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 83
PfeI GAWTC 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 417
PspGI CCWGG 1 cut(s) 417
RsaI GTAC 1 cut(s) 362
RsaNI GTAC 1 cut(s) 361
SaqAI TTAA 4 cut(s) 206, 225, 276, 281
ScrFI CCNGG 1 cut(s) 419
SetI ASST 5 cut(s) 74, 101, 180, 402, 505
SmlI CTYRAG 1 cut(s) 371
SmoI CTYRAG 1 cut(s) 371
Sse9I AATT 6 cut(s) 32, 142, 221, 261, 278, 305
SspMI CTAG 2 cut(s) 69, 438
StyD4I CCNGG 1 cut(s) 417
StyI CCWWGG 2 cut(s) 95, 423
TaaI ACNGT 2 cut(s) 365, 470
TaqI TCGA 1 cut(s) 105
TasI AATT 6 cut(s) 32, 142, 221, 261, 278, 305
TatI WGTACW 1 cut(s) 360
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 4 cut(s) 206, 225, 276, 281
Tru9I TTAA 4 cut(s) 206, 225, 276, 281
TscAI CASTG 2 cut(s) 137, 482
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 3 cut(s) 59, 273, 477
TspRI CASTG 2 cut(s) 137, 482
XapI RAATTY 2 cut(s) 32, 305
XcmI CCANNNNNNNNNTGG 1 cut(s) 135
XmiI GTMKAC 1 cut(s) 367
XspI CTAG 2 cut(s) 69, 438
Zsp2I ATGCAT 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.