RchiOBHm_Chr1g0313061

Protein UPSTREAM OF

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
145964 .. 146364
401 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGGAAGGCAGAGGCGGAGTAGTAGGTGAAATACGGCGACTTAACATCATCTACTTCCTATGTAGTCTTGGCCGCATTGATCATCCCCATCTCATTCGTGTCCATCATCTTAACCGAAACGGCGTTTTTCTGCGAGACATCAAGAGGTGGCTTGCGGATTTACGAGGGAAGGATATGCCAGAGACCTTCACTTGGTCTTACAAGAGGTTCAAATCAATTTTATATATCTTCAATCTTCTTCTATCTTTTTCTTTTGAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

10.41

Weight (kDa)

10.11

Isoelectric Point (pI)

44.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SOK PF06136 15 - 72 7.9e-14 SOSEKI protein DIX-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014395)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G05577
fragaria_vesca FvH4_2g11530
malus_domestica MD07G1001300.v1.1 MD07G1001400.v1.1
prunus_persica Prupe.2G001400_v2.0.a1 Prupe.2G001400_v2.0.a1
pyrus_communis pycom07g00180
rosa_chinensis RchiOBHm_Chr1g0313061
rosa_laevigata RLG00000030824
rosa_multiflora Rmu_sc0001606.1_g000003
rosa_roxburghii Rroxscaffold_4G00332510
rosa_rugosa RorugPtG0000700
rosa_samantha Rh1AG000600 Rh1CG002200 Rh1CG004800 Rh1DG000300
rosa_wichuraiana Rw0G008490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 15, 73, 155
AcoI YGGCCR 1 cut(s) 70
AfiI CCNNNNNNNGG 1 cut(s) 192
AgsI TTSAA 2 cut(s) 211, 232
Alw26I GTCTC 2 cut(s) 129, 176
AoxI GGCC 1 cut(s) 70
AsuHPI GGTGA 1 cut(s) 38
BccI CCATC 2 cut(s) 96, 111
BceAI ACGGC 2 cut(s) 50, 136
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 2 cut(s) 129, 176
BisI GCNGC 1 cut(s) 73
BlsI GCNGC 1 cut(s) 74
BsaI GGTCTC 1 cut(s) 176
Bsc4I CCNNNNNNNGG 1 cut(s) 192
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 192
BshFI GGCC 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 192
BsmAI GTCTC 2 cut(s) 129, 176
BsnI GGCC 1 cut(s) 72
Bso31I GGTCTC 1 cut(s) 176
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 3 cut(s) 15, 73, 155
BspANI GGCC 1 cut(s) 72
BspTNI GGTCTC 1 cut(s) 176
BssMI GATC 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 153
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 2 cut(s) 129, 176
BstMBI GATC 1 cut(s) 79
BsuRI GGCC 1 cut(s) 72
BtsCI GGATG 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 153
CviJI RGCY 2 cut(s) 72, 151
CviKI_1 RGCY 2 cut(s) 72, 151
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
EaeI YGGCCR 1 cut(s) 70
EciI GGCGGA 1 cut(s) 30
Eco31I GGTCTC 1 cut(s) 176
FaiI YATR 4 cut(s) 61, 176, 223, 225
FbaI TGATCA 1 cut(s) 79
Fnu4HI GCNGC 1 cut(s) 73
FokI GGATG 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 73
GluI GCNGC 1 cut(s) 73
HaeIII GGCC 1 cut(s) 72
HphI GGTGA 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 163, 196
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 1 cut(s) 192
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 3 cut(s) 220, 227, 230
MluCI AATT 2 cut(s) 216, 259
MnlI CCTC 4 cut(s) 5, 138, 158, 198
MseI TTAA 3 cut(s) 42, 111, 262
NdeII GATC 1 cut(s) 79
PkrI GCNGC 1 cut(s) 74
SaqAI TTAA 3 cut(s) 42, 111, 262
SatI GCNGC 1 cut(s) 73
Sau3AI GATC 1 cut(s) 79
SetI ASST 4 cut(s) 28, 149, 188, 209
SgeI CNNG 9 cut(s) 80, 110, 146, 154, 164, 176, 191, 204, 214
Sse9I AATT 2 cut(s) 216, 259
SsiI CCGC 3 cut(s) 15, 73, 155
TasI AATT 2 cut(s) 216, 259
TauI GCSGC 1 cut(s) 75
Tru1I TTAA 3 cut(s) 42, 111, 262
Tru9I TTAA 3 cut(s) 42, 111, 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.