RchiOBHm_Chr1g0334971

DNA-directed RNA polymerases I and III subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0004203
Physical Location & Seq
Forward (+)
27181946 .. 27184098
2153 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
ATGGAACTTGGGTCCCTTTCTGATCCCACCCAATCCACATTCTCTTTAGTTGATGAGGATCATACATTCGCAAATGCTATCAGGTTTACTTTGAATCAGGATCCAAGGACGAAATTCTGTGGGTACAGCATTCCTCATCCATCAGATAACCGAGTTAATATTAGAATCCAGACTACAGGTGATCCAGCAAAAGATGTATTCAAAGATGCATGCCAGGATCTCATGGTGATGTGCCAGCATGTGAGCAACACTTTTAACAAGGCTGTGGTTGATTTCAAATTGAGCAACTCTGTGGAGGGCATGGATATTGAATCAGATAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00240 ko01100 ko03020 ko04623 ko05169 map00230 map00240 map01100 map03020 map04623 map05169
Pfam Domains
Protein Families
RNA_pol_L_2

Protein Analysis

107

Amino Acids

11.93

Weight (kDa)

4.63

Isoelectric Point (pI)

30.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_L_2 PF13656 12 - 83 1.4e-27 RNA polymerase Rpb3/Rpb11 dimerisation domain
RNA_pol_L PF01193 13 - 76 2.3e-10 RNA polymerase Rpb3/Rpb11 dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 6 cut(s) 17, 66, 95, 108, 176, 225
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 4 cut(s) 94, 202, 277, 311
AjnI CCWGG 1 cut(s) 213
AlwI GGATC 6 cut(s) 17, 66, 95, 108, 176, 225
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 12
AsuHPI GGTGA 2 cut(s) 191, 238
AvaII GGWCC 1 cut(s) 12
BamHI GGATCC 1 cut(s) 100
BccI CCATC 1 cut(s) 148
BciT130I CCWGG 1 cut(s) 215
BfmI CTRYAG 1 cut(s) 174
Bme1390I CCNGG 1 cut(s) 215
Bme18I GGWCC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 12
BmiI GGNNCC 3 cut(s) 13, 14, 102
BmrFI CCNGG 1 cut(s) 215
BmsI GCATC 1 cut(s) 196
BsaBI GATNNNNATC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 57
BseBI CCWGG 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 104
BseGI GGATG 1 cut(s) 136
BseJI GATNNNNATC 1 cut(s) 57
BsmI GAATGC 1 cut(s) 129
Bsp143I GATC 5 cut(s) 22, 58, 100, 181, 217
BspLI GGNNCC 3 cut(s) 13, 14, 102
BspPI GGATC 6 cut(s) 17, 66, 95, 108, 176, 225
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 5 cut(s) 22, 58, 100, 181, 217
BssT1I CCWWGG 1 cut(s) 104
Bst2UI CCWGG 1 cut(s) 215
BstC8I GCNNGC 2 cut(s) 211, 236
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 5 cut(s) 25, 61, 103, 184, 220
BstMBI GATC 5 cut(s) 22, 58, 100, 181, 217
BstNI CCWGG 1 cut(s) 215
BstNSI RCATGY 2 cut(s) 213, 242
BstSCI CCNGG 1 cut(s) 213
BstSFI CTRYAG 1 cut(s) 174
BstX2I RGATCY 2 cut(s) 100, 217
BstYI RGATCY 2 cut(s) 100, 217
BtsCI GGATG 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 211, 236
Cfr13I GGNCC 1 cut(s) 12
Csp6I GTAC 1 cut(s) 124
CviAII CATG 4 cut(s) 210, 223, 239, 301
CviJI RGCY 1 cut(s) 263
CviKI_1 RGCY 1 cut(s) 263
CviQI GTAC 1 cut(s) 124
DpnI GATC 5 cut(s) 24, 60, 102, 183, 219
DpnII GATC 5 cut(s) 22, 58, 100, 181, 217
Eco130I CCWWGG 1 cut(s) 104
Eco47I GGWCC 1 cut(s) 12
EcoO109I RGGNCCY 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 213
EcoT14I CCWWGG 1 cut(s) 104
EcoT22I ATGCAT 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 104
FaeI CATG 4 cut(s) 213, 226, 242, 304
FaiI YATR 5 cut(s) 63, 211, 224, 240, 302
FatI CATG 4 cut(s) 209, 222, 238, 300
FokI GGATG 1 cut(s) 123
Hin1II CATG 4 cut(s) 213, 226, 242, 304
HinfI GANTC 3 cut(s) 94, 165, 311
HphI GGTGA 2 cut(s) 191, 238
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 3 cut(s) 22, 145, 316
Hpy188III TCNNGA 2 cut(s) 98, 169
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 209
Hsp92II CATG 4 cut(s) 213, 226, 242, 304
KflI GGGWCCC 1 cut(s) 12
Kzo9I GATC 5 cut(s) 22, 58, 100, 181, 217
LpnPI CCDG 8 cut(s) 67, 83, 162, 182, 198, 200, 227, 248
LweI GCATC 1 cut(s) 196
MalI GATC 5 cut(s) 24, 60, 102, 183, 219
MboI GATC 5 cut(s) 22, 58, 100, 181, 217
MflI RGATCY 2 cut(s) 100, 217
MluCI AATT 2 cut(s) 113, 278
MnlI CCTC 3 cut(s) 49, 144, 289
Mph1103I ATGCAT 1 cut(s) 211
MseI TTAA 3 cut(s) 156, 255, 322
MslI CAYNNNNRTG 1 cut(s) 227
MspR9I CCNGG 1 cut(s) 215
Mva1269I GAATGC 1 cut(s) 129
MvaI CCWGG 1 cut(s) 215
NdeII GATC 5 cut(s) 22, 58, 100, 181, 217
NlaIII CATG 4 cut(s) 213, 226, 242, 304
NlaIV GGNNCC 3 cut(s) 13, 14, 102
NsiI ATGCAT 1 cut(s) 211
NspI RCATGY 2 cut(s) 213, 242
PaeI GCATGC 1 cut(s) 213
PctI GAATGC 1 cut(s) 129
PfeI GAWTC 3 cut(s) 94, 165, 311
PpuMI RGGWCCY 1 cut(s) 12
Psp5II RGGWCCY 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
PspN4I GGNNCC 3 cut(s) 13, 14, 102
PspPI GGNCC 1 cut(s) 12
PspPPI RGGWCCY 1 cut(s) 12
PsuI RGATCY 2 cut(s) 100, 217
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
RseI CAYNNNNRTG 1 cut(s) 227
SaqAI TTAA 3 cut(s) 156, 255, 322
Sau3AI GATC 5 cut(s) 22, 58, 100, 181, 217
Sau96I GGNCC 1 cut(s) 12
ScrFI CCNGG 1 cut(s) 215
SetI ASST 2 cut(s) 86, 181
SfaNI GCATC 1 cut(s) 196
SfcI CTRYAG 1 cut(s) 174
SinI GGWCC 1 cut(s) 12
SmiMI CAYNNNNRTG 1 cut(s) 227
SphI GCATGC 1 cut(s) 213
Sse9I AATT 2 cut(s) 113, 278
SspI AATATT 1 cut(s) 160
StyD4I CCNGG 1 cut(s) 213
StyI CCWWGG 1 cut(s) 104
TasI AATT 2 cut(s) 113, 278
TfiI GAWTC 3 cut(s) 94, 165, 311
Tru1I TTAA 3 cut(s) 156, 255, 322
Tru9I TTAA 3 cut(s) 156, 255, 322
VpaK11BI GGWCC 1 cut(s) 12
XapI RAATTY 1 cut(s) 113
XceI RCATGY 2 cut(s) 213, 242
Zsp2I ATGCAT 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.