RchiOBHm_Chr1g0341921

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
33821005 .. 33822926
1922 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGGACTTCTTAGGTTTGAAACCCAAATCTCTCAACAAATTTCTCAACCAAAGCATTTCACAAACACCATGGGACATGCCTCTGAATTCAGCTTCGGCACTTGATCTAGCAACAACTTTTTGTTTCTTGCTACGCCAGGTGACTAAATTTCCACCAACAAAAGTGAAATATCCAGAAGTGGATCTTTTATCTGATTTAGAACTAGCCCAATCTGCATCAATATAG

Protein Analysis

74

Amino Acids

8.27

Weight (kDa)

6.05

Isoelectric Point (pI)

39.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 189
AcsI RAATTY 3 cut(s) 38, 85, 146
AgsI TTSAA 1 cut(s) 19
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AlwI GGATC 1 cut(s) 189
ApoI RAATTY 3 cut(s) 38, 85, 146
AsuHPI GGTGA 1 cut(s) 151
BciT130I CCWGG 1 cut(s) 137
BfaI CTAG 2 cut(s) 107, 203
Bme1390I CCNGG 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 68
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 68
BslFI GGGAC 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 86
Bsp143I GATC 2 cut(s) 103, 181
Bsp19I CCATGG 1 cut(s) 68
BspPI GGATC 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 2 cut(s) 103, 181
BssT1I CCWWGG 1 cut(s) 68
Bst2UI CCWGG 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 10
BstDSI CCRYGG 1 cut(s) 68
BstKTI GATC 2 cut(s) 106, 184
BstMBI GATC 2 cut(s) 103, 181
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstNI CCWGG 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 135
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
BtgI CCRYGG 1 cut(s) 68
CviAII CATG 2 cut(s) 69, 76
CviJI RGCY 2 cut(s) 92, 206
CviKI_1 RGCY 2 cut(s) 92, 206
DdeI CTNAG 1 cut(s) 10
DpnI GATC 2 cut(s) 105, 183
DpnII GATC 2 cut(s) 103, 181
Eco130I CCWWGG 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 68
ErhI CCWWGG 1 cut(s) 68
FaeI CATG 2 cut(s) 72, 79
FaiI YATR 3 cut(s) 70, 77, 223
FalI AAGNNNNNCTT 2 cut(s) 168, 200
FaqI GGGAC 1 cut(s) 86
FatI CATG 2 cut(s) 68, 75
FspBI CTAG 2 cut(s) 107, 203
Hin1II CATG 2 cut(s) 72, 79
HphI GGTGA 1 cut(s) 151
Hpy188I TCNGA 2 cut(s) 84, 193
Hpy188III TCNNGA 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 1 cut(s) 10
Hsp92II CATG 2 cut(s) 72, 79
Kzo9I GATC 2 cut(s) 103, 181
LpnPI CCDG 3 cut(s) 122, 149, 186
MaeI CTAG 2 cut(s) 107, 203
MaeIII GTNAC 1 cut(s) 139
MalI GATC 2 cut(s) 105, 183
MboI GATC 2 cut(s) 103, 181
MflI RGATCY 1 cut(s) 181
MluCI AATT 3 cut(s) 38, 85, 146
MnlI CCTC 1 cut(s) 90
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 212
NcoI CCATGG 1 cut(s) 68
NdeII GATC 2 cut(s) 103, 181
NlaIII CATG 2 cut(s) 72, 79
NmuCI GTSAC 1 cut(s) 139
NspI RCATGY 1 cut(s) 79
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PsuI RGATCY 1 cut(s) 181
Sau3AI GATC 2 cut(s) 103, 181
ScrFI CCNGG 1 cut(s) 137
SetI ASST 3 cut(s) 16, 94, 141
SgeI CNNG 9 cut(s) 81, 88, 113, 119, 139, 148, 149, 185, 215
Sse9I AATT 3 cut(s) 38, 85, 146
SspMI CTAG 2 cut(s) 107, 203
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 68
TasI AATT 3 cut(s) 38, 85, 146
TseFI GTSAC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 139
XapI RAATTY 3 cut(s) 38, 85, 146
XceI RCATGY 1 cut(s) 79
XspI CTAG 2 cut(s) 107, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.