RchiOBHm_Chr1g0370511

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
60030221 .. 60031406
1186 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59467

Sequence Viewer

Length: 156 bp
ATGGCAATATACTCTGATTCAGTAGTAGATAAAGCCACACACTTTTGCAATTTTGACTGCCAAGAAACAGCTCCCCCTGCAAAAGTGAATAAATATCCAGATGTAGACCTCATTGTGTCTACATCTCCAGCTAAATCTGCATCAGTAAAGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.49

Weight (kDa)

5.49

Isoelectric Point (pI)

32.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 105, 119
AluBI AGCT 2 cut(s) 71, 131
AluI AGCT 2 cut(s) 71, 131
BmsI GCATC 1 cut(s) 149
BpmI CTGGAG 1 cut(s) 111
BstMWI GCNNNNNNNGC 2 cut(s) 77, 137
CviJI RGCY 4 cut(s) 35, 71, 131, 151
CviKI_1 RGCY 4 cut(s) 35, 71, 131, 151
FaiI YATR 1 cut(s) 10
FblI GTMKAC 2 cut(s) 105, 119
FspEI CC 9 cut(s) 49, 74, 87, 88, 89, 90, 111, 122, 141
GsuI CTGGAG 1 cut(s) 111
HinfI GANTC 1 cut(s) 17
Hpy166II GTNNAC 2 cut(s) 106, 120
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 2 cut(s) 106, 120
HpyCH4V TGCA 3 cut(s) 48, 80, 140
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 137
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 3 cut(s) 90, 111, 141
LweI GCATC 1 cut(s) 149
MluCI AATT 1 cut(s) 49
MnlI CCTC 1 cut(s) 119
MwoI GCNNNNNNNGC 2 cut(s) 77, 137
PfeI GAWTC 1 cut(s) 17
SetI ASST 3 cut(s) 73, 111, 133
SfaNI GCATC 1 cut(s) 149
SgeI CNNG 4 cut(s) 74, 89, 110, 140
Sse9I AATT 1 cut(s) 49
TasI AATT 1 cut(s) 49
TfiI GAWTC 1 cut(s) 17
XmiI GTMKAC 2 cut(s) 105, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.