RchiOBHm_Chr1g0352271

RING-H2 finger protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0013709
Physical Location & Seq
Reverse (-)
45507263 .. 45509594
2332 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 627 bp
ATGACGATGGGGTCGCATATGAACTTGGTTACTACTGTGATTGGTTTTGGTATGAGTGCAACATTCATTATATTTGTCTGCACAAGAATCATTTGTGGGAGGCTGAGAGGTGTTGAATCAAGGCCTATGTTCGAGATTGAATCAAGAACTGATCTTGAGCAGCCAGAGAATCGGTCTAGTGGCCTTGAACAAATTGTGGTTGCTGCAATCCCGACCATGAAGTATGATCAGGAGGCCTTTAGTTCTTTAGAAGATGCACAGTGTTCAATATGTCTGGGGGAGTACCAGGAGAAAGAAGTATTGAGAATTATGCCGAAATGTGGTCACAGTTTTCACCTCACTTGCATTGATATATGGCTGAGGAAACAGTCTACCTGTCCAGTTTGCCGTTTACCCTTGAAAGAATCTTTCGGACCAAAACATGTGAGATCAGCAACATTTACTGTGGCTCGATCTTTTGATGATTCTGAGAACATTTCAACTCATGAACATTCCCAGCAGTGGCTATTACCAGCATCTGAATCAAATTCGGCAAGCAACAACATTAACAACCAAGTGCGGTTAGAACCTGCTATTGGAAACCCCTCCGAACCTACTCAATCAAGAGAACCAGACACAAGGCATTGA

Protein Analysis

208

Amino Acids

23.38

Weight (kDa)

5.81

Isoelectric Point (pI)

67.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 86 - 130 3.8e-10 RING-H2 zinc finger domain
zf-RING_2 PF13639 87 - 130 9.3e-15 Ring finger domain
zf-RING_11 PF17123 87 - 116 1.5e-10 RING-like zinc finger
zf-C3HC4_2 PF13923 87 - 129 7.5e-09 Zinc finger, C3HC4 type (RING finger)
zf-RING_5 PF14634 87 - 130 4.6e-06 zinc-RING finger domain
zf-C3HC4 PF00097 88 - 129 1.7e-08 Zinc finger, C3HC4 type (RING finger)
zf-RING_UBOX PF13445 88 - 127 3.6e-08 RING-type zinc-finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013709)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g05950 FvH4_7g13140 FvH4_7g13140
malus_domestica MD01G1051600.v1.1 MD07G1128400.v1.1
prunus_persica Prupe.2G154700_v2.0.a1
pyrus_communis pycom01g07620 pycom07g12420
rosa_chinensis RchiOBHm_Chr1g0352271
rosa_laevigata RLG00000028345
rosa_multiflora Rmu_sc0003774.1_g000003
rosa_roxburghii Rroxscaffold_4G00303050
rosa_rugosa Rorug01G0226300
rosa_samantha Rh1AG240700 Rh1BG211600 Rh1CG224500 Rh1DG238000
rosa_wichuraiana Rw1G020850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 10
Acc36I ACCTGC 1 cut(s) 577
AccI GTMKAC 1 cut(s) 371
AciI CCGC 1 cut(s) 559
AcsI RAATTY 1 cut(s) 526
AfaI GTAC 1 cut(s) 284
AfiI CCNNNNNNNGG 3 cut(s) 320, 501, 575
AflIII ACRYGT 1 cut(s) 421
AgsI TTSAA 6 cut(s) 116, 140, 188, 267, 400, 480
AjnI CCWGG 1 cut(s) 285
AjuI GAANNNNNNNTTGG 2 cut(s) 558, 590
AlwNI CAGNNNCTG 1 cut(s) 518
AoxI GGCC 3 cut(s) 122, 181, 234
ApeKI GCWGC 2 cut(s) 160, 203
ApoI RAATTY 1 cut(s) 526
AspS9I GGNCC 1 cut(s) 413
AsuHPI GGTGA 1 cut(s) 326
AvaII GGWCC 1 cut(s) 413
BbvCI CCTCAGC 1 cut(s) 359
BbvI GCAGC 2 cut(s) 172, 190
BceAI ACGGC 1 cut(s) 372
BciT130I CCWGG 1 cut(s) 287
BclI TGATCA 1 cut(s) 226
BfaI CTAG 1 cut(s) 177
BfuAI ACCTGC 1 cut(s) 577
BisI GCNGC 2 cut(s) 161, 204
BlsI GCNGC 2 cut(s) 162, 205
Bme1390I CCNGG 1 cut(s) 287
Bme18I GGWCC 1 cut(s) 413
BmgT120I GGNCC 1 cut(s) 413
BmrFI CCNGG 1 cut(s) 287
BmsI GCATC 2 cut(s) 244, 524
Bpu10I CCTNAGC 1 cut(s) 359
BpuEI CTTGAG 1 cut(s) 176
Bsc4I CCNNNNNNNGG 3 cut(s) 320, 501, 575
Bse1I ACTGG 1 cut(s) 380
BseBI CCWGG 1 cut(s) 287
BseLI CCNNNNNNNGG 3 cut(s) 320, 501, 575
BseMII CTCAG 3 cut(s) 95, 350, 459
BseNI ACTGG 1 cut(s) 380
BseXI GCAGC 2 cut(s) 172, 190
BseYI CCCAGC 1 cut(s) 495
BsgI GTGCAG 1 cut(s) 64
BshFI GGCC 3 cut(s) 124, 183, 236
BslI CCNNNNNNNGG 3 cut(s) 320, 501, 575
BsnI GGCC 3 cut(s) 124, 183, 236
Bsp143I GATC 4 cut(s) 151, 226, 428, 452
BspACI CCGC 1 cut(s) 559
BspANI GGCC 3 cut(s) 124, 183, 236
BspCNI CTCAG 3 cut(s) 96, 351, 460
BspHI TCATGA 1 cut(s) 484
BspMI ACCTGC 1 cut(s) 577
BsrI ACTGG 1 cut(s) 380
BssMI GATC 4 cut(s) 151, 226, 428, 452
Bst2UI CCWGG 1 cut(s) 287
Bst4CI ACNGT 5 cut(s) 37, 261, 329, 369, 445
BstC8I GCNNGC 1 cut(s) 535
BstDEI CTNAG 3 cut(s) 104, 359, 468
BstKTI GATC 4 cut(s) 154, 229, 431, 455
BstMBI GATC 4 cut(s) 151, 226, 428, 452
BstNI CCWGG 1 cut(s) 287
BstNSI RCATGY 1 cut(s) 425
BstSCI CCNGG 1 cut(s) 285
BstV1I GCAGC 2 cut(s) 172, 190
BsuRI GGCC 3 cut(s) 124, 183, 236
BtsI GCAGTG 1 cut(s) 506
BtsIMutI CAGTG 2 cut(s) 266, 506
BveI ACCTGC 1 cut(s) 577
Cac8I GCNNGC 1 cut(s) 535
CaiI CAGNNNCTG 1 cut(s) 518
CciI TCATGA 1 cut(s) 484
Cfr13I GGNCC 1 cut(s) 413
Csp6I GTAC 1 cut(s) 283
CviAII CATG 3 cut(s) 217, 422, 485
CviJI RGCY 8 cut(s) 103, 124, 163, 183, 236, 358, 449, 505
CviKI_1 RGCY 8 cut(s) 103, 124, 163, 183, 236, 358, 449, 505
CviQI GTAC 1 cut(s) 283
DdeI CTNAG 3 cut(s) 104, 359, 468
DpnI GATC 4 cut(s) 153, 228, 430, 454
DpnII GATC 4 cut(s) 151, 226, 428, 452
DrdI GACNNNNNNGTC 1 cut(s) 10
DseDI GACNNNNNNGTC 1 cut(s) 10
Eco147I AGGCCT 2 cut(s) 124, 236
Eco47I GGWCC 1 cut(s) 413
EcoRII CCWGG 1 cut(s) 285
FaeI CATG 3 cut(s) 220, 425, 488
FatI CATG 3 cut(s) 216, 421, 484
FauNDI CATATG 1 cut(s) 18
FbaI TGATCA 1 cut(s) 226
FblI GTMKAC 1 cut(s) 371
Fnu4HI GCNGC 2 cut(s) 161, 204
Fsp4HI GCNGC 2 cut(s) 161, 204
FspBI CTAG 1 cut(s) 177
GluI GCNGC 2 cut(s) 161, 204
GsaI CCCAGC 1 cut(s) 499
HaeIII GGCC 3 cut(s) 124, 183, 236
Hin1II CATG 3 cut(s) 220, 425, 488
HinfI GANTC 7 cut(s) 87, 116, 140, 169, 404, 464, 521
HphI GGTGA 1 cut(s) 326
Hpy166II GTNNAC 2 cut(s) 372, 392
Hpy188I TCNGA 4 cut(s) 413, 469, 520, 589
Hpy188III TCNNGA 7 cut(s) 133, 144, 155, 211, 230, 485, 603
Hpy8I GTNNAC 2 cut(s) 372, 392
HpyCH4III ACNGT 5 cut(s) 37, 261, 329, 369, 445
HpyCH4V TGCA 5 cut(s) 59, 81, 206, 257, 345
HpyF3I CTNAG 3 cut(s) 104, 359, 468
Hsp92II CATG 3 cut(s) 220, 425, 488
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 4 cut(s) 151, 226, 428, 452
Lsp1109I GCAGC 2 cut(s) 172, 190
LweI GCATC 2 cut(s) 244, 524
MaeI CTAG 1 cut(s) 177
MaeIII GTNAC 2 cut(s) 28, 323
MalI GATC 4 cut(s) 153, 228, 430, 454
MboI GATC 4 cut(s) 151, 226, 428, 452
MboII GAAGA 1 cut(s) 263
MluCI AATT 3 cut(s) 192, 306, 526
MnlI CCTC 6 cut(s) 93, 101, 226, 347, 354, 595
MseI TTAA 1 cut(s) 546
MspR9I CCNGG 1 cut(s) 287
MvaI CCWGG 1 cut(s) 287
NdeI CATATG 1 cut(s) 18
NdeII GATC 4 cut(s) 151, 226, 428, 452
NlaIII CATG 3 cut(s) 220, 425, 488
NmuCI GTSAC 1 cut(s) 323
NspI RCATGY 1 cut(s) 425
PagI TCATGA 1 cut(s) 484
PceI AGGCCT 2 cut(s) 124, 236
PciI ACATGT 1 cut(s) 421
PfeI GAWTC 7 cut(s) 87, 116, 140, 169, 404, 464, 521
PkrI GCNGC 2 cut(s) 162, 205
PscI ACATGT 1 cut(s) 421
Psp6I CCWGG 1 cut(s) 285
PspFI CCCAGC 1 cut(s) 495
PspGI CCWGG 1 cut(s) 285
PspPI GGNCC 1 cut(s) 413
PstNI CAGNNNCTG 1 cut(s) 518
RsaI GTAC 1 cut(s) 284
RsaNI GTAC 1 cut(s) 283
SaqAI TTAA 1 cut(s) 546
SatI GCNGC 2 cut(s) 161, 204
Sau3AI GATC 4 cut(s) 151, 226, 428, 452
Sau96I GGNCC 1 cut(s) 413
ScrFI CCNGG 1 cut(s) 287
SetI ASST 5 cut(s) 112, 339, 377, 571, 595
SfaNI GCATC 2 cut(s) 244, 524
SinI GGWCC 1 cut(s) 413
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 3 cut(s) 192, 306, 526
SseBI AGGCCT 2 cut(s) 124, 236
SsiI CCGC 1 cut(s) 559
SspMI CTAG 1 cut(s) 177
StuI AGGCCT 2 cut(s) 124, 236
StyD4I CCNGG 1 cut(s) 285
TaaI ACNGT 5 cut(s) 37, 261, 329, 369, 445
TaqI TCGA 2 cut(s) 132, 451
TaqII GACCGA 1 cut(s) 162
TasI AATT 3 cut(s) 192, 306, 526
TfiI GAWTC 7 cut(s) 87, 116, 140, 169, 404, 464, 521
Tru1I TTAA 1 cut(s) 546
Tru9I TTAA 1 cut(s) 546
TscAI CASTG 2 cut(s) 266, 506
TseFI GTSAC 1 cut(s) 323
TseI GCWGC 2 cut(s) 160, 203
Tsp45I GTSAC 1 cut(s) 323
TspDTI ATGAA 4 cut(s) 35, 55, 233, 501
TspRI CASTG 2 cut(s) 266, 506
VpaK11BI GGWCC 1 cut(s) 413
XapI RAATTY 1 cut(s) 526
XceI RCATGY 1 cut(s) 425
XmiI GTMKAC 1 cut(s) 371
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.