Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003774.1

Orthogroup ID

OG0013709

Physical Location & Seq

Genomic Coordinates Forward (+)

9359 .. 10677

Gene Structure 1319 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003774.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 627 bp

atgacgatggggtcgggtatgaacttgattactactgtgattggttttggtatgagtgcaacgttcattatatttgtctgcacaagaatcatttgtgggaggctcagaggtgttgaatcaaggcctatgttcgagattgaatcaagaactgatcttgagcagccagagaatcggtctagtggccttgaacaaattgtggttgctgcaatcccgaccatgaagtatgatcaggaggcctttagttctttagaagatgcacagtgttcaatatgtctgggggagtaccaggagaaagaagtactgagaattatgccgaaatgtggtcacagttttcacctcacttgcattgatatatggctgaggaaacagtctacctgtccagtttgccgtttacccttgaaagaatctttcggaccaaaacatgtgagatcagcaacatttaccgtggctcgatcttttgatgattctgagaacatttcaactcatgaacattctcagcagtggctattaccagcatctgaaccaaattcggcaagcaacaacattaacaaccaagtgcggttagaacctgtctctggaaacccctccgaacctactcaatcaagagaaccagacacaaggcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004842 GO:0006464 GO:0006508 GO:0006511 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010498 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0019941 GO:0030163 GO:0032446 GO:0036211 GO:0043161 GO:0043170 GO:0043412 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0051603 GO:0061630 GO:0061659 GO:0070647 GO:0071704 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_2

Protein Analysis

208

Amino Acids

23.32

Weight (kDa)

5.7

Isoelectric Point (pI)

68.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013709)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g05950 FvH4_7g13140 FvH4_7g13140
malus_domestica	MD01G1051600.v1.1 MD07G1128400.v1.1
prunus_persica	Prupe.2G154700_v2.0.a1
pyrus_communis	pycom01g07620 pycom07g12420
rosa_chinensis	RchiOBHm_Chr1g0352271
rosa_laevigata	RLG00000028345
rosa_multiflora	Rmu_sc0003774.1_g000003
rosa_roxburghii	Rroxscaffold_4G00303050
rosa_rugosa	Rorug01G0226300
rosa_samantha	Rh1AG240700 Rh1BG211600 Rh1CG224500 Rh1DG238000
rosa_wichuraiana	Rw1G020850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	10
AccI	GTMKAC	1 cut(s)	371
AciI	CCGC	1 cut(s)	559
AclI	AACGTT	1 cut(s)	62
AcsI	RAATTY	1 cut(s)	526
AfaI	GTAC	2 cut(s)	284, 300
AfiI	CCNNNNNNNGG	2 cut(s)	320, 575
AflIII	ACRYGT	1 cut(s)	421
AgsI	TTSAA	6 cut(s)	116, 140, 188, 267, 400, 480
AjnI	CCWGG	1 cut(s)	285
Alw26I	GTCTC	1 cut(s)	577
AlwNI	CAGNNNCTG	1 cut(s)	518
AoxI	GGCC	3 cut(s)	122, 181, 234
ApeKI	GCWGC	2 cut(s)	160, 203
ApoI	RAATTY	1 cut(s)	526
AspS9I	GGNCC	1 cut(s)	413
AsuHPI	GGTGA	1 cut(s)	326
AvaII	GGWCC	1 cut(s)	413
BbvCI	CCTCAGC	1 cut(s)	359
BbvI	GCAGC	2 cut(s)	172, 190
BceAI	ACGGC	1 cut(s)	372
BciT130I	CCWGG	1 cut(s)	287
BclI	TGATCA	1 cut(s)	226
BcoDI	GTCTC	1 cut(s)	577
BfaI	CTAG	1 cut(s)	177
BisI	GCNGC	2 cut(s)	161, 204
BlsI	GCNGC	2 cut(s)	162, 205
BmcAI	AGTACT	1 cut(s)	300
Bme1390I	CCNGG	1 cut(s)	287
Bme18I	GGWCC	1 cut(s)	413
BmgT120I	GGNCC	1 cut(s)	413
BmrFI	CCNGG	1 cut(s)	287
BmsI	GCATC	2 cut(s)	244, 524
Bpu10I	CCTNAGC	1 cut(s)	359
BpuEI	CTTGAG	1 cut(s)	176
BsaJI	CCNNGG	1 cut(s)	444
Bsc4I	CCNNNNNNNGG	2 cut(s)	320, 575
Bse1I	ACTGG	1 cut(s)	380
BseBI	CCWGG	1 cut(s)	287
BseDI	CCNNGG	1 cut(s)	444
BseLI	CCNNNNNNNGG	2 cut(s)	320, 575
BseMII	CTCAG	5 cut(s)	118, 293, 350, 459, 509
BseNI	ACTGG	1 cut(s)	380
BseXI	GCAGC	2 cut(s)	172, 190
BsgI	GTGCAG	1 cut(s)	64
BshFI	GGCC	3 cut(s)	124, 183, 236
BslI	CCNNNNNNNGG	2 cut(s)	320, 575
BsmAI	GTCTC	1 cut(s)	577
BsnI	GGCC	3 cut(s)	124, 183, 236
Bsp143I	GATC	4 cut(s)	151, 226, 428, 452
BspACI	CCGC	1 cut(s)	559
BspANI	GGCC	3 cut(s)	124, 183, 236
BspCNI	CTCAG	5 cut(s)	117, 294, 351, 460, 508
BspHI	TCATGA	1 cut(s)	484
BsrI	ACTGG	1 cut(s)	380
BssECI	CCNNGG	1 cut(s)	444
BssMI	GATC	4 cut(s)	151, 226, 428, 452
Bst2UI	CCWGG	1 cut(s)	287
Bst4CI	ACNGT	5 cut(s)	37, 261, 329, 369, 445
BstC8I	GCNNGC	1 cut(s)	535
BstDEI	CTNAG	5 cut(s)	104, 302, 359, 468, 495
BstDSI	CCRYGG	1 cut(s)	444
BstKTI	GATC	4 cut(s)	154, 229, 431, 455
BstMAI	GTCTC	1 cut(s)	577
BstMBI	GATC	4 cut(s)	151, 226, 428, 452
BstNI	CCWGG	1 cut(s)	287
BstNSI	RCATGY	1 cut(s)	425
BstSCI	CCNGG	1 cut(s)	285
BstV1I	GCAGC	2 cut(s)	172, 190
BsuRI	GGCC	3 cut(s)	124, 183, 236
BtgI	CCRYGG	1 cut(s)	444
BtsI	GCAGTG	1 cut(s)	506
BtsIMutI	CAGTG	2 cut(s)	266, 506
Cac8I	GCNNGC	1 cut(s)	535
CaiI	CAGNNNCTG	1 cut(s)	518
CciI	TCATGA	1 cut(s)	484
Cfr13I	GGNCC	1 cut(s)	413
Csp6I	GTAC	2 cut(s)	283, 299
CviAII	CATG	3 cut(s)	217, 422, 485
CviJI	RGCY	8 cut(s)	103, 124, 163, 183, 236, 358, 449, 505
CviKI_1	RGCY	8 cut(s)	103, 124, 163, 183, 236, 358, 449, 505
CviQI	GTAC	2 cut(s)	283, 299
DdeI	CTNAG	5 cut(s)	104, 302, 359, 468, 495
DpnI	GATC	4 cut(s)	153, 228, 430, 454
DpnII	GATC	4 cut(s)	151, 226, 428, 452
DrdI	GACNNNNNNGTC	1 cut(s)	10
DseDI	GACNNNNNNGTC	1 cut(s)	10
Eco147I	AGGCCT	2 cut(s)	124, 236
Eco47I	GGWCC	1 cut(s)	413
EcoRII	CCWGG	1 cut(s)	285
FaeI	CATG	3 cut(s)	220, 425, 488
FatI	CATG	3 cut(s)	216, 421, 484
FbaI	TGATCA	1 cut(s)	226
FblI	GTMKAC	1 cut(s)	371
Fnu4HI	GCNGC	2 cut(s)	161, 204
Fsp4HI	GCNGC	2 cut(s)	161, 204
FspBI	CTAG	1 cut(s)	177
GluI	GCNGC	2 cut(s)	161, 204
HaeIII	GGCC	3 cut(s)	124, 183, 236
Hin1II	CATG	3 cut(s)	220, 425, 488
HinfI	GANTC	6 cut(s)	87, 116, 140, 169, 404, 464
HphI	GGTGA	1 cut(s)	326
Hpy166II	GTNNAC	2 cut(s)	372, 392
Hpy188I	TCNGA	5 cut(s)	107, 413, 469, 520, 589
Hpy188III	TCNNGA	8 cut(s)	133, 144, 155, 211, 230, 485, 576, 603
Hpy8I	GTNNAC	2 cut(s)	372, 392
HpyCH4III	ACNGT	5 cut(s)	37, 261, 329, 369, 445
HpyCH4IV	ACGT	1 cut(s)	62
HpyCH4V	TGCA	5 cut(s)	59, 81, 206, 257, 345
HpyF3I	CTNAG	5 cut(s)	104, 302, 359, 468, 495
HpySE526I	ACGT	1 cut(s)	62
Hsp92II	CATG	3 cut(s)	220, 425, 488
Ksp22I	TGATCA	1 cut(s)	226
Kzo9I	GATC	4 cut(s)	151, 226, 428, 452
Lsp1109I	GCAGC	2 cut(s)	172, 190
LweI	GCATC	2 cut(s)	244, 524
MaeI	CTAG	1 cut(s)	177
MaeII	ACGT	1 cut(s)	62
MaeIII	GTNAC	1 cut(s)	323
MalI	GATC	4 cut(s)	153, 228, 430, 454
MboI	GATC	4 cut(s)	151, 226, 428, 452
MboII	GAAGA	1 cut(s)	263
MluCI	AATT	3 cut(s)	192, 306, 526
MnlI	CCTC	6 cut(s)	93, 101, 226, 347, 354, 595
MseI	TTAA	1 cut(s)	546
MspR9I	CCNGG	1 cut(s)	287
MvaI	CCWGG	1 cut(s)	287
NdeII	GATC	4 cut(s)	151, 226, 428, 452
NlaIII	CATG	3 cut(s)	220, 425, 488
NmuCI	GTSAC	1 cut(s)	323
NspI	RCATGY	1 cut(s)	425
PagI	TCATGA	1 cut(s)	484
PceI	AGGCCT	2 cut(s)	124, 236
PciI	ACATGT	1 cut(s)	421
PfeI	GAWTC	6 cut(s)	87, 116, 140, 169, 404, 464
PkrI	GCNGC	2 cut(s)	162, 205
PscI	ACATGT	1 cut(s)	421
Psp1406I	AACGTT	1 cut(s)	62
Psp6I	CCWGG	1 cut(s)	285
PspGI	CCWGG	1 cut(s)	285
PspPI	GGNCC	1 cut(s)	413
PstNI	CAGNNNCTG	1 cut(s)	518
RsaI	GTAC	2 cut(s)	284, 300
RsaNI	GTAC	2 cut(s)	283, 299
SaqAI	TTAA	1 cut(s)	546
SatI	GCNGC	2 cut(s)	161, 204
Sau3AI	GATC	4 cut(s)	151, 226, 428, 452
Sau96I	GGNCC	1 cut(s)	413
ScaI	AGTACT	1 cut(s)	300
ScrFI	CCNGG	1 cut(s)	287
SetI	ASST	6 cut(s)	65, 112, 339, 377, 571, 595
SfaNI	GCATC	2 cut(s)	244, 524
SinI	GGWCC	1 cut(s)	413
SmlI	CTYRAG	1 cut(s)	155
SmoI	CTYRAG	1 cut(s)	155
Sse9I	AATT	3 cut(s)	192, 306, 526
SseBI	AGGCCT	2 cut(s)	124, 236
SsiI	CCGC	1 cut(s)	559
SspMI	CTAG	1 cut(s)	177
StuI	AGGCCT	2 cut(s)	124, 236
StyD4I	CCNGG	1 cut(s)	285
TaaI	ACNGT	5 cut(s)	37, 261, 329, 369, 445
TaiI	ACGT	1 cut(s)	65
TaqI	TCGA	2 cut(s)	132, 451
TaqII	GACCGA	1 cut(s)	162
TasI	AATT	3 cut(s)	192, 306, 526
TatI	WGTACW	1 cut(s)	298
TfiI	GAWTC	6 cut(s)	87, 116, 140, 169, 404, 464
Tru1I	TTAA	1 cut(s)	546
Tru9I	TTAA	1 cut(s)	546
TscAI	CASTG	2 cut(s)	266, 506
TseFI	GTSAC	1 cut(s)	323
TseI	GCWGC	2 cut(s)	160, 203
Tsp45I	GTSAC	1 cut(s)	323
TspDTI	ATGAA	4 cut(s)	35, 55, 233, 501
TspRI	CASTG	2 cut(s)	266, 506
VpaK11BI	GGWCC	1 cut(s)	413
XapI	RAATTY	1 cut(s)	526
XceI	RCATGY	1 cut(s)	425
XmiI	GTMKAC	1 cut(s)	371
XspI	CTAG	1 cut(s)	177
ZrmI	AGTACT	1 cut(s)	300

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.