Rmu_sc0003774.1_g000003

RING-H2 finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003774.1
Physical Location & Seq
Forward (+)
9359 .. 10677
1319 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003774.1_g000003.1.cds

Sequence Viewer

Length: 627 bp
atgacgatggggtcgggtatgaacttgattactactgtgattggttttggtatgagtgcaacgttcattatatttgtctgcacaagaatcatttgtgggaggctcagaggtgttgaatcaaggcctatgttcgagattgaatcaagaactgatcttgagcagccagagaatcggtctagtggccttgaacaaattgtggttgctgcaatcccgaccatgaagtatgatcaggaggcctttagttctttagaagatgcacagtgttcaatatgtctgggggagtaccaggagaaagaagtactgagaattatgccgaaatgtggtcacagttttcacctcacttgcattgatatatggctgaggaaacagtctacctgtccagtttgccgtttacccttgaaagaatctttcggaccaaaacatgtgagatcagcaacatttaccgtggctcgatcttttgatgattctgagaacatttcaactcatgaacattctcagcagtggctattaccagcatctgaaccaaattcggcaagcaacaacattaacaaccaagtgcggttagaacctgtctctggaaacccctccgaacctactcaatcaagagaaccagacacaaggcattga

Protein Analysis

208

Amino Acids

23.32

Weight (kDa)

5.7

Isoelectric Point (pI)

68.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013709)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 10
AccI GTMKAC 1 cut(s) 371
AciI CCGC 1 cut(s) 559
AclI AACGTT 1 cut(s) 62
AcsI RAATTY 1 cut(s) 526
AfaI GTAC 2 cut(s) 284, 300
AfiI CCNNNNNNNGG 2 cut(s) 320, 575
AflIII ACRYGT 1 cut(s) 421
AgsI TTSAA 6 cut(s) 116, 140, 188, 267, 400, 480
AjnI CCWGG 1 cut(s) 285
Alw26I GTCTC 1 cut(s) 577
AlwNI CAGNNNCTG 1 cut(s) 518
AoxI GGCC 3 cut(s) 122, 181, 234
ApeKI GCWGC 2 cut(s) 160, 203
ApoI RAATTY 1 cut(s) 526
AspS9I GGNCC 1 cut(s) 413
AsuHPI GGTGA 1 cut(s) 326
AvaII GGWCC 1 cut(s) 413
BbvCI CCTCAGC 1 cut(s) 359
BbvI GCAGC 2 cut(s) 172, 190
BceAI ACGGC 1 cut(s) 372
BciT130I CCWGG 1 cut(s) 287
BclI TGATCA 1 cut(s) 226
BcoDI GTCTC 1 cut(s) 577
BfaI CTAG 1 cut(s) 177
BisI GCNGC 2 cut(s) 161, 204
BlsI GCNGC 2 cut(s) 162, 205
BmcAI AGTACT 1 cut(s) 300
Bme1390I CCNGG 1 cut(s) 287
Bme18I GGWCC 1 cut(s) 413
BmgT120I GGNCC 1 cut(s) 413
BmrFI CCNGG 1 cut(s) 287
BmsI GCATC 2 cut(s) 244, 524
Bpu10I CCTNAGC 1 cut(s) 359
BpuEI CTTGAG 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 444
Bsc4I CCNNNNNNNGG 2 cut(s) 320, 575
Bse1I ACTGG 1 cut(s) 380
BseBI CCWGG 1 cut(s) 287
BseDI CCNNGG 1 cut(s) 444
BseLI CCNNNNNNNGG 2 cut(s) 320, 575
BseMII CTCAG 5 cut(s) 118, 293, 350, 459, 509
BseNI ACTGG 1 cut(s) 380
BseXI GCAGC 2 cut(s) 172, 190
BsgI GTGCAG 1 cut(s) 64
BshFI GGCC 3 cut(s) 124, 183, 236
BslI CCNNNNNNNGG 2 cut(s) 320, 575
BsmAI GTCTC 1 cut(s) 577
BsnI GGCC 3 cut(s) 124, 183, 236
Bsp143I GATC 4 cut(s) 151, 226, 428, 452
BspACI CCGC 1 cut(s) 559
BspANI GGCC 3 cut(s) 124, 183, 236
BspCNI CTCAG 5 cut(s) 117, 294, 351, 460, 508
BspHI TCATGA 1 cut(s) 484
BsrI ACTGG 1 cut(s) 380
BssECI CCNNGG 1 cut(s) 444
BssMI GATC 4 cut(s) 151, 226, 428, 452
Bst2UI CCWGG 1 cut(s) 287
Bst4CI ACNGT 5 cut(s) 37, 261, 329, 369, 445
BstC8I GCNNGC 1 cut(s) 535
BstDEI CTNAG 5 cut(s) 104, 302, 359, 468, 495
BstDSI CCRYGG 1 cut(s) 444
BstKTI GATC 4 cut(s) 154, 229, 431, 455
BstMAI GTCTC 1 cut(s) 577
BstMBI GATC 4 cut(s) 151, 226, 428, 452
BstNI CCWGG 1 cut(s) 287
BstNSI RCATGY 1 cut(s) 425
BstSCI CCNGG 1 cut(s) 285
BstV1I GCAGC 2 cut(s) 172, 190
BsuRI GGCC 3 cut(s) 124, 183, 236
BtgI CCRYGG 1 cut(s) 444
BtsI GCAGTG 1 cut(s) 506
BtsIMutI CAGTG 2 cut(s) 266, 506
Cac8I GCNNGC 1 cut(s) 535
CaiI CAGNNNCTG 1 cut(s) 518
CciI TCATGA 1 cut(s) 484
Cfr13I GGNCC 1 cut(s) 413
Csp6I GTAC 2 cut(s) 283, 299
CviAII CATG 3 cut(s) 217, 422, 485
CviJI RGCY 8 cut(s) 103, 124, 163, 183, 236, 358, 449, 505
CviKI_1 RGCY 8 cut(s) 103, 124, 163, 183, 236, 358, 449, 505
CviQI GTAC 2 cut(s) 283, 299
DdeI CTNAG 5 cut(s) 104, 302, 359, 468, 495
DpnI GATC 4 cut(s) 153, 228, 430, 454
DpnII GATC 4 cut(s) 151, 226, 428, 452
DrdI GACNNNNNNGTC 1 cut(s) 10
DseDI GACNNNNNNGTC 1 cut(s) 10
Eco147I AGGCCT 2 cut(s) 124, 236
Eco47I GGWCC 1 cut(s) 413
EcoRII CCWGG 1 cut(s) 285
FaeI CATG 3 cut(s) 220, 425, 488
FatI CATG 3 cut(s) 216, 421, 484
FbaI TGATCA 1 cut(s) 226
FblI GTMKAC 1 cut(s) 371
Fnu4HI GCNGC 2 cut(s) 161, 204
Fsp4HI GCNGC 2 cut(s) 161, 204
FspBI CTAG 1 cut(s) 177
GluI GCNGC 2 cut(s) 161, 204
HaeIII GGCC 3 cut(s) 124, 183, 236
Hin1II CATG 3 cut(s) 220, 425, 488
HinfI GANTC 6 cut(s) 87, 116, 140, 169, 404, 464
HphI GGTGA 1 cut(s) 326
Hpy166II GTNNAC 2 cut(s) 372, 392
Hpy188I TCNGA 5 cut(s) 107, 413, 469, 520, 589
Hpy188III TCNNGA 8 cut(s) 133, 144, 155, 211, 230, 485, 576, 603
Hpy8I GTNNAC 2 cut(s) 372, 392
HpyCH4III ACNGT 5 cut(s) 37, 261, 329, 369, 445
HpyCH4IV ACGT 1 cut(s) 62
HpyCH4V TGCA 5 cut(s) 59, 81, 206, 257, 345
HpyF3I CTNAG 5 cut(s) 104, 302, 359, 468, 495
HpySE526I ACGT 1 cut(s) 62
Hsp92II CATG 3 cut(s) 220, 425, 488
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 4 cut(s) 151, 226, 428, 452
Lsp1109I GCAGC 2 cut(s) 172, 190
LweI GCATC 2 cut(s) 244, 524
MaeI CTAG 1 cut(s) 177
MaeII ACGT 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 323
MalI GATC 4 cut(s) 153, 228, 430, 454
MboI GATC 4 cut(s) 151, 226, 428, 452
MboII GAAGA 1 cut(s) 263
MluCI AATT 3 cut(s) 192, 306, 526
MnlI CCTC 6 cut(s) 93, 101, 226, 347, 354, 595
MseI TTAA 1 cut(s) 546
MspR9I CCNGG 1 cut(s) 287
MvaI CCWGG 1 cut(s) 287
NdeII GATC 4 cut(s) 151, 226, 428, 452
NlaIII CATG 3 cut(s) 220, 425, 488
NmuCI GTSAC 1 cut(s) 323
NspI RCATGY 1 cut(s) 425
PagI TCATGA 1 cut(s) 484
PceI AGGCCT 2 cut(s) 124, 236
PciI ACATGT 1 cut(s) 421
PfeI GAWTC 6 cut(s) 87, 116, 140, 169, 404, 464
PkrI GCNGC 2 cut(s) 162, 205
PscI ACATGT 1 cut(s) 421
Psp1406I AACGTT 1 cut(s) 62
Psp6I CCWGG 1 cut(s) 285
PspGI CCWGG 1 cut(s) 285
PspPI GGNCC 1 cut(s) 413
PstNI CAGNNNCTG 1 cut(s) 518
RsaI GTAC 2 cut(s) 284, 300
RsaNI GTAC 2 cut(s) 283, 299
SaqAI TTAA 1 cut(s) 546
SatI GCNGC 2 cut(s) 161, 204
Sau3AI GATC 4 cut(s) 151, 226, 428, 452
Sau96I GGNCC 1 cut(s) 413
ScaI AGTACT 1 cut(s) 300
ScrFI CCNGG 1 cut(s) 287
SetI ASST 6 cut(s) 65, 112, 339, 377, 571, 595
SfaNI GCATC 2 cut(s) 244, 524
SinI GGWCC 1 cut(s) 413
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 3 cut(s) 192, 306, 526
SseBI AGGCCT 2 cut(s) 124, 236
SsiI CCGC 1 cut(s) 559
SspMI CTAG 1 cut(s) 177
StuI AGGCCT 2 cut(s) 124, 236
StyD4I CCNGG 1 cut(s) 285
TaaI ACNGT 5 cut(s) 37, 261, 329, 369, 445
TaiI ACGT 1 cut(s) 65
TaqI TCGA 2 cut(s) 132, 451
TaqII GACCGA 1 cut(s) 162
TasI AATT 3 cut(s) 192, 306, 526
TatI WGTACW 1 cut(s) 298
TfiI GAWTC 6 cut(s) 87, 116, 140, 169, 404, 464
Tru1I TTAA 1 cut(s) 546
Tru9I TTAA 1 cut(s) 546
TscAI CASTG 2 cut(s) 266, 506
TseFI GTSAC 1 cut(s) 323
TseI GCWGC 2 cut(s) 160, 203
Tsp45I GTSAC 1 cut(s) 323
TspDTI ATGAA 4 cut(s) 35, 55, 233, 501
TspRI CASTG 2 cut(s) 266, 506
VpaK11BI GGWCC 1 cut(s) 413
XapI RAATTY 1 cut(s) 526
XceI RCATGY 1 cut(s) 425
XmiI GTMKAC 1 cut(s) 371
XspI CTAG 1 cut(s) 177
ZrmI AGTACT 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.