RchiOBHm_Chr1g0377721

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
64496555 .. 64498948
2394 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 369 bp
ATGCTCTTGAGTTTGGGGCGATTTGGCTTCCTTAATATCTGGCCTTCTGTCACCAAAATCTTGTTCAAAAAGCAATGGAACAATTTCTTAATGATCCGCAAAGAACTAGAAGATGTGTTCATTCCTCTTATACAAGAACGAAGCAAGTCAAAGCAGGAGAGGCTGAGCAAGGTGGACCAAAGTGATGAATTTGTGCTGTCGTATGTTGATACATTGCAGGATCTCCAGCTCCCTGAAGAGAAGAGAAAGCTTGGGGAAGAAGAAATAGTTAGCCTTTGTTACGAGATTCTCATGGCAGGAGTTGATACTACATCCACTGCATTGCTCTGGATCATGGCCAACATAGTCAAGTATCCACATGTACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

14.31

Weight (kDa)

5.45

Isoelectric Point (pI)

52.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 7 - 122 4.5e-16 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 97
AclWI GGATC 3 cut(s) 88, 228, 338
AcoI YGGCCR 1 cut(s) 336
AcsI RAATTY 1 cut(s) 188
AcuI CTGAAG 1 cut(s) 255
AfaI GTAC 1 cut(s) 363
AflIII ACRYGT 1 cut(s) 358
AgsI TTSAA 1 cut(s) 67
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AluBI AGCT 2 cut(s) 229, 250
AluI AGCT 2 cut(s) 229, 250
AlwI GGATC 3 cut(s) 88, 228, 338
AoxI GGCC 2 cut(s) 41, 336
ApoI RAATTY 1 cut(s) 188
Asp700I GAANNNNTTC 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 43
AvaII GGWCC 1 cut(s) 175
BalI TGGCCA 1 cut(s) 338
BciVI GTATCC 1 cut(s) 363
BfaI CTAG 1 cut(s) 107
BfuI GTATCC 1 cut(s) 363
BlpI GCTNAGC 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 175
BpmI CTGGAG 1 cut(s) 209
Bpu1102I GCTNAGC 1 cut(s) 164
BpuEI CTTGAG 1 cut(s) 28
Bse3DI GCAATG 3 cut(s) 80, 212, 320
BseGI GGATG 1 cut(s) 311
BseMI GCAATG 3 cut(s) 80, 212, 320
BseMII CTCAG 1 cut(s) 155
BshFI GGCC 2 cut(s) 43, 338
BsnI GGCC 2 cut(s) 43, 338
Bsp1407I TGTACA 1 cut(s) 361
Bsp143I GATC 3 cut(s) 93, 220, 330
Bsp1720I GCTNAGC 1 cut(s) 164
BspACI CCGC 1 cut(s) 97
BspANI GGCC 2 cut(s) 43, 338
BspCNI CTCAG 1 cut(s) 156
BspPI GGATC 3 cut(s) 88, 228, 338
BsrDI GCAATG 3 cut(s) 80, 212, 320
BsrGI TGTACA 1 cut(s) 361
BssMI GATC 3 cut(s) 93, 220, 330
Bst6I CTCTTC 2 cut(s) 231, 236
BstAUI TGTACA 1 cut(s) 361
BstDEI CTNAG 1 cut(s) 164
BstF5I GGATG 1 cut(s) 311
BstKTI GATC 3 cut(s) 96, 223, 333
BstMBI GATC 3 cut(s) 93, 220, 330
BstMWI GCNNNNNNNGC 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 362
BstX2I RGATCY 1 cut(s) 220
BstYI RGATCY 1 cut(s) 220
BsuI GTATCC 1 cut(s) 363
BsuRI GGCC 2 cut(s) 43, 338
BtsCI GGATG 1 cut(s) 311
BtsI GCAGTG 1 cut(s) 315
BtsIMutI CAGTG 1 cut(s) 315
Cfr13I GGNCC 1 cut(s) 175
Csp6I GTAC 1 cut(s) 362
CviAII CATG 3 cut(s) 292, 334, 359
CviJI RGCY 7 cut(s) 27, 43, 163, 229, 250, 273, 338
CviKI_1 RGCY 7 cut(s) 27, 43, 163, 229, 250, 273, 338
CviQI GTAC 1 cut(s) 362
DdeI CTNAG 1 cut(s) 164
DpnI GATC 3 cut(s) 95, 222, 332
DpnII GATC 3 cut(s) 93, 220, 330
EaeI YGGCCR 1 cut(s) 336
Eam1104I CTCTTC 2 cut(s) 231, 236
EarI CTCTTC 2 cut(s) 231, 236
Eco47I GGWCC 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 255
FaeI CATG 3 cut(s) 295, 337, 362
FaiI YATR 6 cut(s) 131, 204, 293, 335, 344, 360
FatI CATG 3 cut(s) 291, 333, 358
FokI GGATG 1 cut(s) 298
FspBI CTAG 1 cut(s) 107
GsuI CTGGAG 1 cut(s) 209
HaeIII GGCC 2 cut(s) 43, 338
Hin1II CATG 3 cut(s) 295, 337, 362
HindIII AAGCTT 1 cut(s) 248
HinfI GANTC 1 cut(s) 286
HphI GGTGA 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 175
Hpy188III TCNNGA 2 cut(s) 7, 328
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 54
HpyCH4V TGCA 2 cut(s) 217, 320
HpyF10VI GCNNNNNNNGC 1 cut(s) 160
HpyF3I CTNAG 1 cut(s) 164
Hsp92II CATG 3 cut(s) 295, 337, 362
Kzo9I GATC 3 cut(s) 93, 220, 330
LmnI GCTCC 1 cut(s) 234
LpnPI CCDG 7 cut(s) 25, 140, 203, 239, 246, 282, 313
MaeI CTAG 1 cut(s) 107
MaeIII GTNAC 2 cut(s) 49, 278
MalI GATC 3 cut(s) 95, 222, 332
MboI GATC 3 cut(s) 93, 220, 330
MboII GAAGA 5 cut(s) 122, 248, 253, 269, 272
MflI RGATCY 1 cut(s) 220
MlsI TGGCCA 1 cut(s) 338
MluCI AATT 2 cut(s) 82, 188
MluNI TGGCCA 1 cut(s) 338
MnlI CCTC 2 cut(s) 135, 153
Mox20I TGGCCA 1 cut(s) 338
MroXI GAANNNNTTC 1 cut(s) 83
MscI TGGCCA 1 cut(s) 338
MseI TTAA 2 cut(s) 33, 89
Msp20I TGGCCA 1 cut(s) 338
MwoI GCNNNNNNNGC 1 cut(s) 160
NdeII GATC 3 cut(s) 93, 220, 330
NlaIII CATG 3 cut(s) 295, 337, 362
NmuCI GTSAC 1 cut(s) 49
NspI RCATGY 1 cut(s) 362
PciI ACATGT 1 cut(s) 358
PdmI GAANNNNTTC 1 cut(s) 83
PfeI GAWTC 1 cut(s) 286
PscI ACATGT 1 cut(s) 358
PspPI GGNCC 1 cut(s) 175
PsuI RGATCY 1 cut(s) 220
RsaI GTAC 1 cut(s) 363
RsaNI GTAC 1 cut(s) 362
SaqAI TTAA 2 cut(s) 33, 89
Sau3AI GATC 3 cut(s) 93, 220, 330
Sau96I GGNCC 1 cut(s) 175
SetI ASST 3 cut(s) 174, 231, 252
SinI GGWCC 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 2 cut(s) 82, 188
SsiI CCGC 1 cut(s) 97
SspMI CTAG 1 cut(s) 107
TasI AATT 2 cut(s) 82, 188
TatI WGTACW 1 cut(s) 361
TfiI GAWTC 1 cut(s) 286
Tru1I TTAA 2 cut(s) 33, 89
Tru9I TTAA 2 cut(s) 33, 89
TscAI CASTG 1 cut(s) 322
TseFI GTSAC 1 cut(s) 49
Tsp45I GTSAC 1 cut(s) 49
TspDTI ATGAA 2 cut(s) 109, 201
TspRI CASTG 1 cut(s) 322
VpaK11BI GGWCC 1 cut(s) 175
XapI RAATTY 1 cut(s) 188
XceI RCATGY 1 cut(s) 362
XmnI GAANNNNTTC 1 cut(s) 83
XspI CTAG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.