Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005704.1

Orthogroup ID

OG0014824

Physical Location & Seq

Genomic Coordinates Forward (+)

34688 .. 35020

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005704.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 333 bp

atggtggcggatattgggtgggacccagaggtgtgggaagagcctatagagtttaagccggagaggtttttgagtaaggagggaggagatcaggggtttgatataatagggagcagagagattaagatgatgccgtttggggttgggaggaggatttgccctggacttggtttggctgtgcttcatctggagttttttgtggtgaatttggtgtggaaattcgagtggagaggtgtgaagggagaggatgttgacttcgcggagaagcaagagttcacaatggttatgaggaatccattgaaggcgaacatttcaccaagagtgatgaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00140 ko00380 ko00830 ko00980 ko01100 ko04913 ko04917 ko04927 ko04934 ko05204 map00140 map00380 map00830 map00980 map01100 map04913 map04917 map04927 map04934 map05204

Pfam Domains

Protein Families

p450

Protein Analysis

110

Amino Acids

12.7

Weight (kDa)

5.22

Isoelectric Point (pI)

46.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014824)

Species	Orthologous Gene IDs
prunus_persica	Prupe.2G296400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0377721 RchiOBHm_Chr1g0377731 RchiOBHm_Chr7g0221591
rosa_multiflora	Rmu_sc0000084.1_g000042 Rmu_sc0005704.1_g000012 Rmu_sc0038902.1_g000003
rosa_roxburghii	Rroxscaffold_1G00044760 Rroxscaffold_3G00238270
rosa_rugosa	Rorug05G0152000
rosa_samantha	Rh1AG427900 Rh1BG381500 Rh1CG395400 Rh1DG412500 Rh2BG374100 Rh2DG390900 Rh5CG277000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	260
AciI	CCGC	2 cut(s)	8, 260
AcsI	RAATTY	2 cut(s)	205, 218
AfiI	CCNNNNNNNGG	1 cut(s)	167
AgsI	TTSAA	1 cut(s)	301
AjnI	CCWGG	1 cut(s)	160
ApoI	RAATTY	2 cut(s)	205, 218
AspS9I	GGNCC	1 cut(s)	22
AsuHPI	GGTGA	2 cut(s)	214, 306
AvaII	GGWCC	1 cut(s)	22
BceAI	ACGGC	1 cut(s)	118
BciT130I	CCWGG	1 cut(s)	162
BfmI	CTRYAG	1 cut(s)	45
Bme1390I	CCNGG	1 cut(s)	162
Bme18I	GGWCC	1 cut(s)	22
BmgT120I	GGNCC	1 cut(s)	22
BmiI	GGNNCC	2 cut(s)	23, 24
BmrFI	CCNGG	1 cut(s)	162
BmsI	GCATC	1 cut(s)	120
BpmI	CTGGAG	1 cut(s)	209
BsaJI	CCNNGG	1 cut(s)	160
BsaXI	ACNNNNNCTCC	2 cut(s)	234, 264
Bsc4I	CCNNNNNNNGG	1 cut(s)	167
BseBI	CCWGG	1 cut(s)	162
BseDI	CCNNGG	1 cut(s)	160
BseGI	GGATG	1 cut(s)	253
BseLI	CCNNNNNNNGG	1 cut(s)	167
BseRI	GAGGAG	2 cut(s)	99, 163
Bsh1236I	CGCG	1 cut(s)	260
BsiSI	CCGG	1 cut(s)	59
BslFI	GGGAC	1 cut(s)	35
BslI	CCNNNNNNNGG	1 cut(s)	167
BsmFI	GGGAC	1 cut(s)	35
Bsp143I	GATC	1 cut(s)	88
BspACI	CCGC	2 cut(s)	8, 260
BspFNI	CGCG	1 cut(s)	260
BspLI	GGNNCC	2 cut(s)	23, 24
BspQI	GCTCTTC	1 cut(s)	33
BssECI	CCNNGG	1 cut(s)	160
BssMI	GATC	1 cut(s)	88
Bst2UI	CCWGG	1 cut(s)	162
Bst6I	CTCTTC	1 cut(s)	33
BstF5I	GGATG	1 cut(s)	253
BstFNI	CGCG	1 cut(s)	260
BstKTI	GATC	1 cut(s)	91
BstMBI	GATC	1 cut(s)	88
BstNI	CCWGG	1 cut(s)	162
BstSCI	CCNGG	1 cut(s)	160
BstSFI	CTRYAG	1 cut(s)	45
BstUI	CGCG	1 cut(s)	260
BstXI	CCANNNNNNTGG	1 cut(s)	33
BtsCI	GGATG	1 cut(s)	253
Cfr13I	GGNCC	1 cut(s)	22
CviJI	RGCY	3 cut(s)	43, 58, 176
CviKI_1	RGCY	3 cut(s)	43, 58, 176
DpnI	GATC	1 cut(s)	90
DpnII	GATC	1 cut(s)	88
Eam1104I	CTCTTC	1 cut(s)	33
EarI	CTCTTC	1 cut(s)	33
EciI	GGCGGA	1 cut(s)	23
Eco47I	GGWCC	1 cut(s)	22
EcoO109I	RGGNCCY	1 cut(s)	22
EcoRII	CCWGG	1 cut(s)	160
FaiI	YATR	3 cut(s)	47, 104, 287
FaqI	GGGAC	1 cut(s)	35
FokI	GGATG	1 cut(s)	260
GsuI	CTGGAG	1 cut(s)	209
HapII	CCGG	1 cut(s)	59
HincII	GTYRAC	1 cut(s)	253
HindII	GTYRAC	1 cut(s)	253
HinfI	GANTC	1 cut(s)	292
HpaII	CCGG	1 cut(s)	59
HphI	GGTGA	2 cut(s)	214, 306
Hpy166II	GTNNAC	2 cut(s)	253, 276
Hpy188III	TCNNGA	1 cut(s)	188
Hpy8I	GTNNAC	2 cut(s)	253, 276
HpyAV	CCTTC	2 cut(s)	232, 295
KflI	GGGWCCC	1 cut(s)	22
Kzo9I	GATC	1 cut(s)	88
LguI	GCTCTTC	1 cut(s)	33
LmnI	GCTCC	1 cut(s)	111
LpnPI	CCDG	6 cut(s)	39, 72, 77, 147, 173, 174
LweI	GCATC	1 cut(s)	120
MalI	GATC	1 cut(s)	90
MboI	GATC	1 cut(s)	88
MboII	GAAGA	1 cut(s)	50
MluCI	AATT	2 cut(s)	205, 218
MnlI	CCTC	9 cut(s)	22, 57, 73, 77, 141, 144, 224, 238, 282
MseI	TTAA	2 cut(s)	54, 123
MspI	CCGG	1 cut(s)	59
MspR9I	CCNGG	1 cut(s)	162
MvaI	CCWGG	1 cut(s)	162
MvnI	CGCG	1 cut(s)	260
NdeII	GATC	1 cut(s)	88
NlaIV	GGNNCC	2 cut(s)	23, 24
PciSI	GCTCTTC	1 cut(s)	33
PfeI	GAWTC	1 cut(s)	292
PpuMI	RGGWCCY	1 cut(s)	22
Psp5II	RGGWCCY	1 cut(s)	22
Psp6I	CCWGG	1 cut(s)	160
PspGI	CCWGG	1 cut(s)	160
PspN4I	GGNNCC	2 cut(s)	23, 24
PspPI	GGNCC	1 cut(s)	22
PspPPI	RGGWCCY	1 cut(s)	22
SapI	GCTCTTC	1 cut(s)	33
SaqAI	TTAA	2 cut(s)	54, 123
Sau3AI	GATC	1 cut(s)	88
Sau96I	GGNCC	1 cut(s)	22
ScrFI	CCNGG	1 cut(s)	162
SetI	ASST	3 cut(s)	33, 68, 235
SfaNI	GCATC	1 cut(s)	120
SfcI	CTRYAG	1 cut(s)	45
SinI	GGWCC	1 cut(s)	22
Sse9I	AATT	2 cut(s)	205, 218
SsiI	CCGC	2 cut(s)	8, 260
StyD4I	CCNGG	1 cut(s)	160
TaqI	TCGA	1 cut(s)	222
TasI	AATT	2 cut(s)	205, 218
TfiI	GAWTC	1 cut(s)	292
Tru1I	TTAA	2 cut(s)	54, 123
Tru9I	TTAA	2 cut(s)	54, 123
TspDTI	ATGAA	1 cut(s)	173
VpaK11BI	GGWCC	1 cut(s)	22
XapI	RAATTY	2 cut(s)	205, 218

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.