RchiOBHm_Chr1g0324531

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
12283013 .. 12283189
177 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55437

Sequence Viewer

Length: 177 bp
ATGAACAGCCCTTGGAGGGACAGACCAATTAAAGAGTCGATGAAGCTTTTTGAGGATATGAGGCGTGGCCTGATTGAAGAAGGGAAAGCAACTGTAAGAATGAAACAAGACATGCAGAGTGATAATTTTAACATGTATGACCTTATTGCATATCGTATCAAGTTTATGTTGGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

58

Amino Acids

7.05

Weight (kDa)

9.22

Isoelectric Point (pI)

56.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1c PF00749 2 - 55 1.5e-12 tRNA synthetases class I (E and Q), catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 16
AflIII ACRYGT 1 cut(s) 132
AgsI TTSAA 1 cut(s) 77
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
AoxI GGCC 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 16
BshFI GGCC 1 cut(s) 69
BslFI GGGAC 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 16
BsmFI GGGAC 1 cut(s) 32
BsnI GGCC 1 cut(s) 69
BspANI GGCC 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 11
BssT1I CCWWGG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 94
BstNSI RCATGY 2 cut(s) 115, 136
BsuRI GGCC 1 cut(s) 69
CviAII CATG 2 cut(s) 112, 133
CviJI RGCY 3 cut(s) 9, 46, 69
CviKI_1 RGCY 3 cut(s) 9, 46, 69
Eco130I CCWWGG 1 cut(s) 11
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
FaeI CATG 2 cut(s) 115, 136
FaiI YATR 6 cut(s) 59, 113, 134, 138, 151, 167
FaqI GGGAC 1 cut(s) 32
FatI CATG 2 cut(s) 111, 132
HaeIII GGCC 1 cut(s) 69
Hin1II CATG 2 cut(s) 115, 136
HindIII AAGCTT 1 cut(s) 44
HinfI GANTC 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 115, 149
Hsp92II CATG 2 cut(s) 115, 136
LpnPI CCDG 1 cut(s) 83
MboII GAAGA 1 cut(s) 89
MluCI AATT 2 cut(s) 27, 124
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 3 cut(s) 9, 46, 54
MseI TTAA 2 cut(s) 30, 129
NlaIII CATG 2 cut(s) 115, 136
NspI RCATGY 2 cut(s) 115, 136
PciI ACATGT 1 cut(s) 132
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
PscI ACATGT 1 cut(s) 132
SaqAI TTAA 2 cut(s) 30, 129
SchI GAGTC 1 cut(s) 44
SetI ASST 2 cut(s) 48, 144
SgeI CNNG 7 cut(s) 24, 77, 82, 119, 124, 145, 172
Sse9I AATT 2 cut(s) 27, 124
StyI CCWWGG 1 cut(s) 11
TaaI ACNGT 1 cut(s) 94
TaqI TCGA 1 cut(s) 38
TasI AATT 2 cut(s) 27, 124
Tru1I TTAA 2 cut(s) 30, 129
Tru9I TTAA 2 cut(s) 30, 129
TspDTI ATGAA 3 cut(s) 17, 56, 116
XceI RCATGY 2 cut(s) 115, 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.