Rh2CG569800

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
74990300 .. 74991917
1618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG569800.1

Sequence Viewer

Length: 285 bp
ATGTGGAAGCCTGCAAAACTAGAGGAAATTGCTATTGCTGTTTCTACCCTGAATAGCCAGTTGAAGAAATTCTTAATCCATATGCGATATTCCCTCAACCAGAGGAAAACTTTAAGGTTCATACTTCAGTTTTCTTTAGTGATGCTGAATGGATATATACATATAGGCCATGCCAAGGCAATGTTTATTGACTTTGGCCTGGCAAAAGAGAGAGGTGGTGGCTGCTATCTGAGCAGTCCAATATTGGTGAAGATGATGACCTCCCTCAATTCAATAGCAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

94

Amino Acids

10.68

Weight (kDa)

10.08

Isoelectric Point (pI)

38.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1c PF00749 50 - 77 6.9e-07 tRNA synthetases class I (E and Q), catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 68
AcuI CTGAAG 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 2 cut(s) 64, 273
AjnI CCWGG 1 cut(s) 198
AoxI GGCC 2 cut(s) 166, 196
ApeKI GCWGC 1 cut(s) 222
ApoI RAATTY 1 cut(s) 68
Asp700I GAANNNNTTC 1 cut(s) 68
AsuHPI GGTGA 1 cut(s) 259
BbvI GCAGC 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 200
BfaI CTAG 1 cut(s) 20
BisI GCNGC 1 cut(s) 223
BlsI GCNGC 1 cut(s) 224
Bme1390I CCNGG 1 cut(s) 200
BmrFI CCNGG 1 cut(s) 200
BmsI GCATC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 175
Bse1I ACTGG 1 cut(s) 58
Bse3DI GCAATG 2 cut(s) 186, 285
BseBI CCWGG 1 cut(s) 200
BseDI CCNNGG 1 cut(s) 174
BseLI CCNNNNNNNGG 1 cut(s) 175
BseMI GCAATG 2 cut(s) 186, 285
BseMII CTCAG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 58
BseXI GCAGC 1 cut(s) 209
BshFI GGCC 2 cut(s) 168, 198
BslI CCNNNNNNNGG 1 cut(s) 175
BsnI GGCC 2 cut(s) 168, 198
BspANI GGCC 2 cut(s) 168, 198
BspCNI CTCAG 1 cut(s) 222
BsrDI GCAATG 2 cut(s) 186, 285
BsrI ACTGG 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 174
BssT1I CCWWGG 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 200
BstC8I GCNNGC 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 230
BstMWI GCNNNNNNNGC 1 cut(s) 231
BstNI CCWGG 1 cut(s) 200
BstSCI CCNGG 1 cut(s) 198
BstV1I GCAGC 1 cut(s) 209
BsuRI GGCC 2 cut(s) 168, 198
Cac8I GCNNGC 1 cut(s) 12
CviAII CATG 1 cut(s) 170
CviJI RGCY 5 cut(s) 10, 57, 168, 198, 222
CviKI_1 RGCY 5 cut(s) 10, 57, 168, 198, 222
DdeI CTNAG 1 cut(s) 230
Eco130I CCWWGG 1 cut(s) 174
Eco57I CTGAAG 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 1 cut(s) 173
FaiI YATR 8 cut(s) 81, 83, 122, 156, 158, 162, 164, 171
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FatI CATG 1 cut(s) 169
FauNDI CATATG 1 cut(s) 81
Fnu4HI GCNGC 1 cut(s) 223
Fsp4HI GCNGC 1 cut(s) 223
FspBI CTAG 1 cut(s) 20
GluI GCNGC 1 cut(s) 223
HaeIII GGCC 2 cut(s) 168, 198
Hin1II CATG 1 cut(s) 173
HphI GGTGA 1 cut(s) 259
Hpy188I TCNGA 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 14
HpyF10VI GCNNNNNNNGC 1 cut(s) 231
HpyF3I CTNAG 1 cut(s) 230
Hsp92II CATG 1 cut(s) 173
LpnPI CCDG 6 cut(s) 24, 62, 71, 113, 185, 212
Lsp1109I GCAGC 1 cut(s) 209
LweI GCATC 1 cut(s) 132
MaeI CTAG 1 cut(s) 20
MboII GAAGA 2 cut(s) 76, 262
MluCI AATT 3 cut(s) 27, 68, 268
MnlI CCTC 6 cut(s) 16, 96, 104, 206, 271, 275
MroXI GAANNNNTTC 1 cut(s) 68
MseI TTAA 2 cut(s) 74, 113
MspR9I CCNGG 1 cut(s) 200
MvaI CCWGG 1 cut(s) 200
MwoI GCNNNNNNNGC 1 cut(s) 231
NdeI CATATG 1 cut(s) 81
NlaIII CATG 1 cut(s) 173
PdmI GAANNNNTTC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 224
Psp6I CCWGG 1 cut(s) 198
PspGI CCWGG 1 cut(s) 198
SaqAI TTAA 2 cut(s) 74, 113
SatI GCNGC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 200
SetI ASST 3 cut(s) 119, 217, 263
SfaNI GCATC 1 cut(s) 132
SgeI CNNG 9 cut(s) 23, 32, 61, 70, 112, 182, 187, 211, 212
Sse9I AATT 3 cut(s) 27, 68, 268
SspI AATATT 1 cut(s) 243
SspMI CTAG 1 cut(s) 20
StyD4I CCNGG 1 cut(s) 198
StyI CCWWGG 1 cut(s) 174
TasI AATT 3 cut(s) 27, 68, 268
Tru1I TTAA 2 cut(s) 74, 113
Tru9I TTAA 2 cut(s) 74, 113
TseI GCWGC 1 cut(s) 222
TspDTI ATGAA 1 cut(s) 109
XapI RAATTY 1 cut(s) 68
XmnI GAANNNNTTC 1 cut(s) 68
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.