RchiOBHm_Chr1g0324621

Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
12401436 .. 12404776
3341 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55445

Sequence Viewer

Length: 180 bp
ATGTCTATTTTCAAAAGCATGCGCCAATTGGAGTTGAAGCTTTATGTACCTGGTTCACATCAAATTAAACCACTGGCAATATTCCTCAGAGACTATGTGAACATGATTGCTGGGAAGTATCCTTTCTGGAATCGCACACATGGGACAGATCATTTTCTTGTTGCTTGCCATGATTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

7.02

Weight (kDa)

9.36

Isoelectric Point (pI)

31.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Exostosin_GT47 PF03016 24 - 58 5.4e-09 Exostosin GT47 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 48
AgsI TTSAA 2 cut(s) 13, 37
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
Alw26I GTCTC 1 cut(s) 84
AspLEI GCGC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 51
BciVI GTATCC 1 cut(s) 129
BcoDI GTCTC 1 cut(s) 84
BfuI GTATCC 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 100
BseNI ACTGG 1 cut(s) 78
BseYI CCCAGC 1 cut(s) 110
BslFI GGGAC 1 cut(s) 157
BsmAI GTCTC 1 cut(s) 84
BsmFI GGGAC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 148
BspCNI CTCAG 1 cut(s) 99
BsrI ACTGG 1 cut(s) 78
BssMI GATC 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 51
BstC8I GCNNGC 2 cut(s) 20, 166
BstDEI CTNAG 1 cut(s) 86
BstHHI GCGC 1 cut(s) 24
BstKTI GATC 1 cut(s) 151
BstMAI GTCTC 1 cut(s) 84
BstMBI GATC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 22
BstSCI CCNGG 1 cut(s) 49
BsuI GTATCC 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 71
Cac8I GCNNGC 2 cut(s) 20, 166
CfoI GCGC 1 cut(s) 24
CsiI ACCWGGT 1 cut(s) 49
Csp6I GTAC 1 cut(s) 47
CviAII CATG 4 cut(s) 19, 103, 140, 170
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 1 cut(s) 86
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 49
FaeI CATG 4 cut(s) 22, 106, 143, 173
FaiI YATR 6 cut(s) 20, 45, 96, 104, 141, 171
FaqI GGGAC 1 cut(s) 157
FatI CATG 4 cut(s) 18, 102, 139, 169
GlaI GCGC 1 cut(s) 23
GsaI CCCAGC 1 cut(s) 114
HhaI GCGC 1 cut(s) 24
Hin1II CATG 4 cut(s) 22, 106, 143, 173
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
HindIII AAGCTT 1 cut(s) 38
HinfI GANTC 1 cut(s) 130
Hpy166II GTNNAC 2 cut(s) 56, 100
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 127
Hpy8I GTNNAC 2 cut(s) 56, 100
HpyF3I CTNAG 1 cut(s) 86
Hsp92II CATG 4 cut(s) 22, 106, 143, 173
HspAI GCGC 1 cut(s) 22
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 5 cut(s) 36, 59, 63, 96, 112
MabI ACCWGGT 1 cut(s) 49
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MfeI CAATTG 1 cut(s) 26
MluCI AATT 2 cut(s) 26, 63
MnlI CCTC 1 cut(s) 95
MseI TTAA 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 51
MunI CAATTG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 51
NdeII GATC 1 cut(s) 148
NlaIII CATG 4 cut(s) 22, 106, 143, 173
NspI RCATGY 1 cut(s) 22
PaeI GCATGC 1 cut(s) 22
PfeI GAWTC 1 cut(s) 130
Psp6I CCWGG 1 cut(s) 49
PspFI CCCAGC 1 cut(s) 110
PspGI CCWGG 1 cut(s) 49
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 51
SetI ASST 2 cut(s) 42, 52
SexAI ACCWGGT 1 cut(s) 49
SgeI CNNG 9 cut(s) 31, 62, 63, 86, 115, 123, 139, 152, 170
SphI GCATGC 1 cut(s) 22
Sse9I AATT 2 cut(s) 26, 63
SspI AATATT 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 49
TasI AATT 2 cut(s) 26, 63
TfiI GAWTC 1 cut(s) 130
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TscAI CASTG 1 cut(s) 78
TspRI CASTG 1 cut(s) 78
XceI RCATGY 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.