Rroxscaffold_2G00095150

Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
16452925 .. 16457282
4358 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00095150.1

Sequence Viewer

Length: 231 bp
ATGGAGGGAAACAGGCAATTCGTCACAAGAGACCCAGAAAAGGCTCGCTTATTTTATCTTCCTCACAGCATGCGCCAATTGGAGTTGAAGCTTTATGTGCCTGGTTTACATGAAATTAAACCACTGGCAATACTCCTCAGAGACTATATGAACATGATTGCTGGAAGTATCCTTTCTGGAATCACACACATGGGACAAATCATTTTGTTGCTAGCCATGACTGAAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.7

Weight (kDa)

8.16

Isoelectric Point (pI)

37.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 1 cut(s) 100
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
Alw26I GTCTC 2 cut(s) 24, 135
AspLEI GCGC 1 cut(s) 75
AsuNHI GCTAGC 1 cut(s) 211
BciT130I CCWGG 1 cut(s) 102
BciVI GTATCC 1 cut(s) 179
BcoDI GTCTC 2 cut(s) 24, 135
BfaI CTAG 1 cut(s) 212
BfuI GTATCC 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 102
BmtI GCTAGC 1 cut(s) 215
BsaI GGTCTC 1 cut(s) 24
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 129
BseBI CCWGG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 151
BseNI ACTGG 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 125
BslFI GGGAC 1 cut(s) 207
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 2 cut(s) 24, 135
BsmFI GGGAC 1 cut(s) 207
Bso31I GGTCTC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 150
BspOI GCTAGC 1 cut(s) 215
BspTNI GGTCTC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 102
BstC8I GCNNGC 3 cut(s) 46, 71, 213
BstDEI CTNAG 1 cut(s) 137
BstHHI GCGC 1 cut(s) 75
BstMAI GTCTC 2 cut(s) 24, 135
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 102
BstNSI RCATGY 1 cut(s) 73
BstSCI CCNGG 1 cut(s) 100
BsuI GTATCC 1 cut(s) 179
BtsIMutI CAGTG 1 cut(s) 122
Cac8I GCNNGC 3 cut(s) 46, 71, 213
CfoI GCGC 1 cut(s) 75
CviAII CATG 5 cut(s) 70, 110, 154, 190, 217
CviJI RGCY 4 cut(s) 44, 91, 215, 228
CviKI_1 RGCY 4 cut(s) 44, 91, 215, 228
DdeI CTNAG 1 cut(s) 137
Eco31I GGTCTC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 100
FaeI CATG 5 cut(s) 73, 113, 157, 193, 220
FaiI YATR 8 cut(s) 71, 96, 111, 147, 149, 155, 191, 218
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FaqI GGGAC 1 cut(s) 207
FatI CATG 5 cut(s) 69, 109, 153, 189, 216
FspBI CTAG 1 cut(s) 212
GlaI GCGC 1 cut(s) 74
HhaI GCGC 1 cut(s) 75
Hin1II CATG 5 cut(s) 73, 113, 157, 193, 220
Hin6I GCGC 1 cut(s) 73
HinP1I GCGC 1 cut(s) 73
HindIII AAGCTT 1 cut(s) 89
HinfI GANTC 1 cut(s) 180
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 177
Hpy8I GTNNAC 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 137
Hsp92II CATG 5 cut(s) 73, 113, 157, 193, 220
HspAI GCGC 1 cut(s) 73
LpnPI CCDG 6 cut(s) 48, 87, 110, 114, 147, 162
MaeI CTAG 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 22
MboII GAAGA 1 cut(s) 50
MfeI CAATTG 1 cut(s) 77
MluCI AATT 3 cut(s) 17, 77, 114
MnlI CCTC 2 cut(s) 72, 146
MseI TTAA 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 188
MspR9I CCNGG 1 cut(s) 102
MunI CAATTG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 97
NheI GCTAGC 1 cut(s) 211
NlaIII CATG 5 cut(s) 73, 113, 157, 193, 220
NmuCI GTSAC 1 cut(s) 22
NspI RCATGY 1 cut(s) 73
PaeI GCATGC 1 cut(s) 73
PfeI GAWTC 1 cut(s) 180
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
RseI CAYNNNNRTG 1 cut(s) 188
SaqAI TTAA 1 cut(s) 117
ScrFI CCNGG 1 cut(s) 102
SetI ASST 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 188
SphI GCATGC 1 cut(s) 73
Sse9I AATT 3 cut(s) 17, 77, 114
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 100
TasI AATT 3 cut(s) 17, 77, 114
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TscAI CASTG 1 cut(s) 129
TseFI GTSAC 1 cut(s) 22
Tsp45I GTSAC 1 cut(s) 22
TspDTI ATGAA 2 cut(s) 126, 164
TspRI CASTG 1 cut(s) 129
XceI RCATGY 1 cut(s) 73
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.