Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0011611

Physical Location & Seq

Genomic Coordinates Reverse (-)

46295327 .. 46299279

Gene Structure 3953 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00199510.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGGTTCATGAGGTTGATGGAGGGAAACAGGCAATTTGTCACAAGAGACCAGAAAAGTACAAGCCATTTTATCTTCCTTACAGCATGCGCCAATTGGAGTTGAAGCTTTATGTACCTGGTTCACATCAAATTAAACCACTGGCAATATTCCTCCAGAGACTATGTGAACATGATTGCTGGGAAGTATCCTTTCTGGAGATCGCACACATGGGACAGATCATTTTTCTTGTTGCTTGCCATGACTGGGTTGGTAATCTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Exostosin

Protein Analysis

86

Amino Acids

10.09

Weight (kDa)

7.0

Isoelectric Point (pI)

45.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011611)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0324621 RchiOBHm_Chr2g0152761 RchiOBHm_Chr3g0465441 RchiOBHm_Chr4g0408921 RchiOBHm_Chr4g0421771 RchiOBHm_Chr4g0446141 RchiOBHm_Chr6g0251001 RchiOBHm_Chr6g0252321 RchiOBHm_Chr6g0309421
rosa_roxburghii	Rroxscaffold_2G00095150 Rroxscaffold_4G00316580 Rroxscaffold_5G00341190 Rroxscaffold_7G00199510
rosa_rugosa	Rorug07G0160600.1
rosa_samantha	Rh1DG034600 Rh4AG152500 Rh4CG161000 Rh5AG100200 Rh5BG423500
rosa_wichuraiana	Rw5G046940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	2 cut(s)	59, 114
AfiI	CCNNNNNNNGG	1 cut(s)	244
AgsI	TTSAA	1 cut(s)	103
AjnI	CCWGG	1 cut(s)	115
AluBI	AGCT	1 cut(s)	106
AluI	AGCT	1 cut(s)	106
Alw26I	GTCTC	2 cut(s)	40, 151
AspLEI	GCGC	1 cut(s)	90
BccI	CCATC	1 cut(s)	11
BciT130I	CCWGG	1 cut(s)	117
BciVI	GTATCC	1 cut(s)	196
BcoDI	GTCTC	2 cut(s)	40, 151
BfuI	GTATCC	1 cut(s)	196
Bme1390I	CCNGG	1 cut(s)	117
BmrFI	CCNGG	1 cut(s)	117
BmrI	ACTGGG	1 cut(s)	253
BmuI	ACTGGG	1 cut(s)	253
BpmI	CTGGAG	2 cut(s)	137, 215
BsaI	GGTCTC	1 cut(s)	40
Bsc4I	CCNNNNNNNGG	1 cut(s)	244
Bse1I	ACTGG	2 cut(s)	144, 248
BseBI	CCWGG	1 cut(s)	117
BseLI	CCNNNNNNNGG	1 cut(s)	244
BseNI	ACTGG	2 cut(s)	144, 248
BseYI	CCCAGC	1 cut(s)	177
BslFI	GGGAC	1 cut(s)	225
BslI	CCNNNNNNNGG	1 cut(s)	244
BsmAI	GTCTC	2 cut(s)	40, 151
BsmFI	GGGAC	1 cut(s)	225
Bso31I	GGTCTC	1 cut(s)	40
Bsp143I	GATC	2 cut(s)	198, 216
BspHI	TCATGA	1 cut(s)	7
BspTNI	GGTCTC	1 cut(s)	40
BsrI	ACTGG	2 cut(s)	144, 248
BssMI	GATC	2 cut(s)	198, 216
Bst2UI	CCWGG	1 cut(s)	117
BstC8I	GCNNGC	2 cut(s)	86, 235
BstHHI	GCGC	1 cut(s)	90
BstKTI	GATC	2 cut(s)	201, 219
BstMAI	GTCTC	2 cut(s)	40, 151
BstMBI	GATC	2 cut(s)	198, 216
BstNI	CCWGG	1 cut(s)	117
BstNSI	RCATGY	1 cut(s)	88
BstSCI	CCNGG	1 cut(s)	115
BsuI	GTATCC	1 cut(s)	196
BtsIMutI	CAGTG	1 cut(s)	137
Cac8I	GCNNGC	2 cut(s)	86, 235
CciI	TCATGA	1 cut(s)	7
CfoI	GCGC	1 cut(s)	90
CsiI	ACCWGGT	1 cut(s)	115
Csp6I	GTAC	2 cut(s)	58, 113
CviAII	CATG	5 cut(s)	8, 85, 170, 208, 239
CviJI	RGCY	2 cut(s)	64, 106
CviKI_1	RGCY	2 cut(s)	64, 106
CviQI	GTAC	2 cut(s)	58, 113
DpnI	GATC	2 cut(s)	200, 218
DpnII	GATC	2 cut(s)	198, 216
Eco31I	GGTCTC	1 cut(s)	40
EcoRII	CCWGG	1 cut(s)	115
FaeI	CATG	5 cut(s)	11, 88, 173, 211, 242
FaiI	YATR	7 cut(s)	9, 86, 111, 163, 171, 209, 240
FaqI	GGGAC	1 cut(s)	225
FatI	CATG	5 cut(s)	7, 84, 169, 207, 238
GlaI	GCGC	1 cut(s)	89
GsaI	CCCAGC	1 cut(s)	181
GsuI	CTGGAG	2 cut(s)	137, 215
HhaI	GCGC	1 cut(s)	90
Hin1II	CATG	5 cut(s)	11, 88, 173, 211, 242
Hin6I	GCGC	1 cut(s)	88
HinP1I	GCGC	1 cut(s)	88
HindIII	AAGCTT	1 cut(s)	104
Hpy166II	GTNNAC	2 cut(s)	122, 167
Hpy188III	TCNNGA	3 cut(s)	8, 154, 194
Hpy8I	GTNNAC	2 cut(s)	122, 167
Hsp92II	CATG	5 cut(s)	11, 88, 173, 211, 242
HspAI	GCGC	1 cut(s)	88
Kzo9I	GATC	2 cut(s)	198, 216
LpnPI	CCDG	9 cut(s)	14, 63, 102, 125, 129, 163, 167, 179, 229
MabI	ACCWGGT	1 cut(s)	115
MaeIII	GTNAC	1 cut(s)	38
MalI	GATC	2 cut(s)	200, 218
MboI	GATC	2 cut(s)	198, 216
MboII	GAAGA	1 cut(s)	65
MfeI	CAATTG	1 cut(s)	92
MluCI	AATT	3 cut(s)	33, 92, 129
MnlI	CCTC	3 cut(s)	4, 14, 161
MseI	TTAA	1 cut(s)	132
MspR9I	CCNGG	1 cut(s)	117
MunI	CAATTG	1 cut(s)	92
MvaI	CCWGG	1 cut(s)	117
NdeII	GATC	2 cut(s)	198, 216
NlaIII	CATG	5 cut(s)	11, 88, 173, 211, 242
NmuCI	GTSAC	1 cut(s)	38
NspI	RCATGY	1 cut(s)	88
PaeI	GCATGC	1 cut(s)	88
PagI	TCATGA	1 cut(s)	7
Psp6I	CCWGG	1 cut(s)	115
PspFI	CCCAGC	1 cut(s)	177
PspGI	CCWGG	1 cut(s)	115
RsaI	GTAC	2 cut(s)	59, 114
RsaNI	GTAC	2 cut(s)	58, 113
SaqAI	TTAA	1 cut(s)	132
Sau3AI	GATC	2 cut(s)	198, 216
ScrFI	CCNGG	1 cut(s)	117
SetI	ASST	3 cut(s)	15, 108, 118
SexAI	ACCWGGT	1 cut(s)	115
SphI	GCATGC	1 cut(s)	88
Sse9I	AATT	3 cut(s)	33, 92, 129
SspI	AATATT	1 cut(s)	147
StyD4I	CCNGG	1 cut(s)	115
TasI	AATT	3 cut(s)	33, 92, 129
TatI	WGTACW	1 cut(s)	57
Tru1I	TTAA	1 cut(s)	132
Tru9I	TTAA	1 cut(s)	132
TscAI	CASTG	1 cut(s)	144
TseFI	GTSAC	1 cut(s)	38
Tsp45I	GTSAC	1 cut(s)	38
TspRI	CASTG	1 cut(s)	144
XceI	RCATGY	1 cut(s)	88
XcmI	CCANNNNNNNNNTGG	1 cut(s)	245

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.