RchiOBHm_Chr1g0376421

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
63658834 .. 63664356
5523 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60005

Sequence Viewer

Length: 240 bp
ATGAAAGCTTTGGAAATGTTATCCCCTCAAGATGCTGAAGCCTGCAGCATAAGGGAGGAACTTGATATACTGATGACACTGCAGCAGCCTTTAAGTGGAAGTTGTAACAATTCATTGGAGACAGCAAAAATATGCAACGGTAGAGAATTTAAAAGCAGCACTCGTAGAAATTCAACTATGTTCCAGGTTGGTGTCTCTGTTACTAAAGAAGAAATCCTTGAACAATGGGGACTCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.82

Weight (kDa)

4.83

Isoelectric Point (pI)

58.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 146, 169
AcuI CTGAAG 1 cut(s) 57
AfiI CCNNNNNNNGG 1 cut(s) 95
AgsI TTSAA 2 cut(s) 174, 221
AjnI CCWGG 1 cut(s) 183
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
Alw26I GTCTC 2 cut(s) 113, 199
ApeKI GCWGC 4 cut(s) 45, 82, 85, 156
ApoI RAATTY 2 cut(s) 146, 169
AsuHPI GGTGA 1 cut(s) 226
BbvI GCAGC 4 cut(s) 57, 94, 97, 168
BciT130I CCWGG 1 cut(s) 185
BcoDI GTCTC 2 cut(s) 113, 199
BfmI CTRYAG 2 cut(s) 43, 80
BisI GCNGC 4 cut(s) 46, 83, 86, 157
BlsI GCNGC 4 cut(s) 47, 84, 87, 158
Bme1390I CCNGG 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 185
BmsI GCATC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 12
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 185
BseLI CCNNNNNNNGG 1 cut(s) 95
BseXI GCAGC 4 cut(s) 57, 94, 97, 168
BslI CCNNNNNNNGG 1 cut(s) 95
BsmAI GTCTC 2 cut(s) 113, 199
BspMAI CTGCAG 2 cut(s) 47, 84
Bst2UI CCWGG 1 cut(s) 185
Bst4CI ACNGT 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 43
BstMAI GTCTC 2 cut(s) 113, 199
BstNI CCWGG 1 cut(s) 185
BstSCI CCNGG 1 cut(s) 183
BstSFI CTRYAG 2 cut(s) 43, 80
BstV1I GCAGC 4 cut(s) 57, 94, 97, 168
BtsI GCAGTG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 43
CviJI RGCY 3 cut(s) 8, 41, 88
CviKI_1 RGCY 3 cut(s) 8, 41, 88
DraI TTTAAA 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 57
EcoRII CCWGG 1 cut(s) 183
FaiI YATR 4 cut(s) 50, 68, 133, 179
FalI AAGNNNNNCTT 2 cut(s) 201, 233
Fnu4HI GCNGC 4 cut(s) 46, 83, 86, 157
Fsp4HI GCNGC 4 cut(s) 46, 83, 86, 157
GluI GCNGC 4 cut(s) 46, 83, 86, 157
HindIII AAGCTT 1 cut(s) 6
HinfI GANTC 1 cut(s) 231
HphI GGTGA 1 cut(s) 226
Hpy188III TCNNGA 1 cut(s) 29
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 3 cut(s) 45, 82, 135
LpnPI CCDG 3 cut(s) 55, 170, 197
Lsp1109I GCAGC 4 cut(s) 57, 94, 97, 168
LweI GCATC 1 cut(s) 22
MaeIII GTNAC 2 cut(s) 104, 199
MboII GAAGA 1 cut(s) 221
MluCI AATT 3 cut(s) 109, 146, 169
MlyI GAGTC 1 cut(s) 225
MnlI CCTC 2 cut(s) 36, 49
MseI TTAA 2 cut(s) 92, 150
MspR9I CCNGG 1 cut(s) 185
MvaI CCWGG 1 cut(s) 185
PkrI GCNGC 4 cut(s) 47, 84, 87, 158
PleI GAGTC 1 cut(s) 225
PpsI GAGTC 1 cut(s) 225
Psp6I CCWGG 1 cut(s) 183
PspGI CCWGG 1 cut(s) 183
PsrI GAACNNNNNNTAC 2 cut(s) 51, 83
PstI CTGCAG 2 cut(s) 47, 84
SaqAI TTAA 2 cut(s) 92, 150
SatI GCNGC 4 cut(s) 46, 83, 86, 157
SchI GAGTC 1 cut(s) 225
ScrFI CCNGG 1 cut(s) 185
SetI ASST 3 cut(s) 10, 189, 239
SfaNI GCATC 1 cut(s) 22
SfcI CTRYAG 2 cut(s) 43, 80
SgeI CNNG 7 cut(s) 41, 54, 74, 174, 196, 197, 230
SmlI CTYRAG 1 cut(s) 27
SmoI CTYRAG 1 cut(s) 27
Sse9I AATT 3 cut(s) 109, 146, 169
StyD4I CCNGG 1 cut(s) 183
TaaI ACNGT 1 cut(s) 140
TasI AATT 3 cut(s) 109, 146, 169
Tru1I TTAA 2 cut(s) 92, 150
Tru9I TTAA 2 cut(s) 92, 150
TscAI CASTG 1 cut(s) 84
TseI GCWGC 4 cut(s) 45, 82, 85, 156
TspDTI ATGAA 2 cut(s) 17, 102
TspRI CASTG 1 cut(s) 84
XapI RAATTY 2 cut(s) 146, 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.