RchiOBHm_Chr1g0380641

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
66237509 .. 66240806
3298 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60390

Sequence Viewer

Length: 267 bp
ATGGAATTGAGTTCATGGCCAGTTGTTGGGCTGGGCTTTTTTGCTGGGGTGTTGGGCTGGGCTTCAATACGTCGAGCTTTGGAAGTTTCTCGAAAATCAGGATTTTTGGGTGGGAAGTTTCATAACCTTCTTTCTCATTCAATTGCTGCCAAAACAATTGAGAGAGAGATCAATTATCAAGAACGATCGAGAGAGAGAGAGATAAATAAGGTGTGTTTCTTTGCTTTGCACGAAGAGATAGAGAGAGAGATCGGAGGGAAATTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.04

Weight (kDa)

8.98

Isoelectric Point (pI)

58.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 26
AcoI YGGCCR 1 cut(s) 17
AcsI RAATTY 1 cut(s) 260
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 2 cut(s) 66, 141
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
AoxI GGCC 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 260
BalI TGGCCA 1 cut(s) 19
BbvI GCAGC 1 cut(s) 133
BisI GCNGC 1 cut(s) 147
BlsI GCNGC 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 20
BseLI CCNNNNNNNGG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 20
BseXI GCAGC 1 cut(s) 133
BseYI CCCAGC 3 cut(s) 31, 44, 57
Bsh1285I CGRYCG 1 cut(s) 188
BshFI GGCC 1 cut(s) 19
BsiEI CGRYCG 1 cut(s) 188
BslI CCNNNNNNNGG 1 cut(s) 26
BsnI GGCC 1 cut(s) 19
Bsp143I GATC 3 cut(s) 168, 185, 249
BspANI GGCC 1 cut(s) 19
BsrI ACTGG 1 cut(s) 20
BssMI GATC 3 cut(s) 168, 185, 249
Bst6I CTCTTC 1 cut(s) 228
BstKTI GATC 3 cut(s) 171, 188, 252
BstMBI GATC 3 cut(s) 168, 185, 249
BstMCI CGRYCG 1 cut(s) 188
BstV1I GCAGC 1 cut(s) 133
BsuRI GGCC 1 cut(s) 19
CviAII CATG 1 cut(s) 15
CviJI RGCY 6 cut(s) 19, 31, 36, 57, 62, 77
CviKI_1 RGCY 6 cut(s) 19, 31, 36, 57, 62, 77
DpnI GATC 3 cut(s) 170, 187, 251
DpnII GATC 3 cut(s) 168, 185, 249
EaeI YGGCCR 1 cut(s) 17
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
FaeI CATG 1 cut(s) 18
FaiI YATR 2 cut(s) 16, 123
FatI CATG 1 cut(s) 14
Fnu4HI GCNGC 1 cut(s) 147
Fsp4HI GCNGC 1 cut(s) 147
GluI GCNGC 1 cut(s) 147
GsaI CCCAGC 3 cut(s) 35, 48, 61
HaeIII GGCC 1 cut(s) 19
Hin1II CATG 1 cut(s) 18
Hpy188I TCNGA 2 cut(s) 254, 266
Hpy188III TCNNGA 4 cut(s) 90, 99, 179, 189
Hpy99I CGWCG 1 cut(s) 75
HpyAV CCTTC 1 cut(s) 137
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 229
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 1 cut(s) 18
Kzo9I GATC 3 cut(s) 168, 185, 249
LpnPI CCDG 5 cut(s) 17, 30, 33, 43, 84
Lsp1109I GCAGC 1 cut(s) 133
MaeII ACGT 1 cut(s) 70
MalI GATC 3 cut(s) 170, 187, 251
MboI GATC 3 cut(s) 168, 185, 249
MboII GAAGA 1 cut(s) 245
MfeI CAATTG 2 cut(s) 141, 156
MlsI TGGCCA 1 cut(s) 19
MluCI AATT 5 cut(s) 5, 141, 156, 172, 260
MluNI TGGCCA 1 cut(s) 19
MnlI CCTC 1 cut(s) 248
Mox20I TGGCCA 1 cut(s) 19
MscI TGGCCA 1 cut(s) 19
Msp20I TGGCCA 1 cut(s) 19
MunI CAATTG 2 cut(s) 141, 156
NdeII GATC 3 cut(s) 168, 185, 249
NlaIII CATG 1 cut(s) 18
PflMI CCANNNNNTGG 1 cut(s) 26
PkrI GCNGC 1 cut(s) 148
Ple19I CGATCG 1 cut(s) 188
PspFI CCCAGC 3 cut(s) 31, 44, 57
PvuI CGATCG 1 cut(s) 188
SatI GCNGC 1 cut(s) 147
Sau3AI GATC 3 cut(s) 168, 185, 249
SetI ASST 4 cut(s) 73, 79, 129, 213
Sse9I AATT 5 cut(s) 5, 141, 156, 172, 260
TaiI ACGT 1 cut(s) 73
TaqI TCGA 3 cut(s) 73, 91, 188
TasI AATT 5 cut(s) 5, 141, 156, 172, 260
TseI GCWGC 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 110
Van91I CCANNNNNTGG 1 cut(s) 26
XapI RAATTY 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.