RchiOBHm_Chr1g0381011

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66427381 .. 66429175
1795 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60421

Sequence Viewer

Length: 243 bp
ATGGGAGGAGGAGCACATTTTTTGAAGAGAATTCCCAGAATCAAATTCCCACAAAGACACCCAAAATCCTCAGCTTCAGGTTCTACTTCACATACTCAAGATGCATCATCAGCTAGTCTAGGGTCAGATGTTCCAGCGCCACTGAAAAACCCTGGCGTCGGAGGGAAGGCCTCTCTTCAGCCCGAACGCACACCTGTGACAGCCAGAGAAATAGATGCCATAATATCAGGTGGATGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.19

Weight (kDa)

10.17

Isoelectric Point (pI)

41.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 30, 44
AcuI CTGAAG 2 cut(s) 60, 161
AcyI GRCGYC 1 cut(s) 156
AfiI CCNNNNNNNGG 1 cut(s) 158
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 1 cut(s) 151
AleI CACNNNNGTG 1 cut(s) 194
AluBI AGCT 2 cut(s) 74, 113
AluI AGCT 2 cut(s) 74, 113
Alw21I GWGCWC 1 cut(s) 16
AoxI GGCC 1 cut(s) 168
ApoI RAATTY 2 cut(s) 30, 44
AspLEI GCGC 1 cut(s) 139
Bbv12I GWGCWC 1 cut(s) 16
BbvCI CCTCAGC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 153
BfaI CTAG 2 cut(s) 114, 119
BfoI RGCGCY 1 cut(s) 140
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BmsI GCATC 4 cut(s) 91, 113, 205, 224
Bpu10I CCTNAGC 1 cut(s) 70
BpuEI CTTGAG 1 cut(s) 81
BsaHI GRCGYC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 151
Bsc4I CCNNNNNNNGG 1 cut(s) 158
BseBI CCWGG 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 151
BseGI GGATG 1 cut(s) 239
BseLI CCNNNNNNNGG 1 cut(s) 158
BseMII CTCAG 1 cut(s) 84
BseRI GAGGAG 2 cut(s) 21, 24
BshFI GGCC 1 cut(s) 170
BsiHKAI GWGCWC 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 158
BsnI GGCC 1 cut(s) 170
Bsp1286I GDGCHC 1 cut(s) 16
BspANI GGCC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 151
BssNI GRCGYC 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 153
Bst6I CTCTTC 2 cut(s) 20, 180
BstACI GRCGYC 1 cut(s) 156
BstDEI CTNAG 1 cut(s) 70
BstF5I GGATG 1 cut(s) 239
BstH2I RGCGCY 1 cut(s) 140
BstHHI GCGC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
BsuRI GGCC 1 cut(s) 170
BtsCI GGATG 1 cut(s) 239
BtsIMutI CAGTG 1 cut(s) 140
CfoI GCGC 1 cut(s) 139
CseI GACGC 1 cut(s) 145
CviJI RGCY 5 cut(s) 74, 113, 170, 181, 203
CviKI_1 RGCY 5 cut(s) 74, 113, 170, 181, 203
DdeI CTNAG 1 cut(s) 70
Eam1104I CTCTTC 2 cut(s) 20, 180
EarI CTCTTC 2 cut(s) 20, 180
Eco147I AGGCCT 1 cut(s) 170
Eco57I CTGAAG 2 cut(s) 60, 161
EcoRI GAATTC 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 151
EcoT22I ATGCAT 2 cut(s) 106, 239
FaiI YATR 2 cut(s) 93, 221
FspBI CTAG 2 cut(s) 114, 119
GlaI GCGC 1 cut(s) 138
HaeII RGCGCY 1 cut(s) 140
HaeIII GGCC 1 cut(s) 170
HgaI GACGC 1 cut(s) 145
HhaI GCGC 1 cut(s) 139
Hin1I GRCGYC 1 cut(s) 156
Hin6I GCGC 1 cut(s) 137
HinP1I GCGC 1 cut(s) 137
HinfI GANTC 1 cut(s) 39
Hpy188I TCNGA 2 cut(s) 127, 161
Hpy188III TCNNGA 1 cut(s) 98
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 104, 237
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpyF3I CTNAG 1 cut(s) 70
Hsp92I GRCGYC 1 cut(s) 156
HspAI GCGC 1 cut(s) 137
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 8 cut(s) 49, 63, 138, 147, 165, 207, 213, 217
LweI GCATC 4 cut(s) 91, 113, 205, 224
MaeI CTAG 2 cut(s) 114, 119
MaeIII GTNAC 1 cut(s) 196
MboII GAAGA 2 cut(s) 37, 167
MhlI GDGCHC 1 cut(s) 16
MluCI AATT 2 cut(s) 30, 44
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 3 cut(s) 79, 155, 181
Mph1103I ATGCAT 2 cut(s) 106, 239
MslI CAYNNNNRTG 1 cut(s) 194
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
MwoI GCNNNNNNNGC 1 cut(s) 110
NmuCI GTSAC 1 cut(s) 196
NsiI ATGCAT 2 cut(s) 106, 239
OliI CACNNNNGTG 1 cut(s) 194
PceI AGGCCT 1 cut(s) 170
PfeI GAWTC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
RseI CAYNNNNRTG 1 cut(s) 194
ScrFI CCNGG 1 cut(s) 153
SduI GDGCHC 1 cut(s) 16
SetI ASST 5 cut(s) 76, 82, 115, 196, 232
SfaNI GCATC 4 cut(s) 91, 113, 205, 224
SmiMI CAYNNNNRTG 1 cut(s) 194
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
Sse9I AATT 2 cut(s) 30, 44
SseBI AGGCCT 1 cut(s) 170
SspMI CTAG 2 cut(s) 114, 119
StuI AGGCCT 1 cut(s) 170
StyD4I CCNGG 1 cut(s) 151
TasI AATT 2 cut(s) 30, 44
TfiI GAWTC 1 cut(s) 39
TscAI CASTG 1 cut(s) 147
TseFI GTSAC 1 cut(s) 196
Tsp45I GTSAC 1 cut(s) 196
TspRI CASTG 1 cut(s) 147
XapI RAATTY 2 cut(s) 30, 44
XspI CTAG 2 cut(s) 114, 119
Zsp2I ATGCAT 2 cut(s) 106, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.