RchiOBHm_Chr2g0104481

Belongs to the bacterial ribosomal protein bL17 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
15825157 .. 15827382
2226 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47875

Sequence Viewer

Length: 267 bp
ATGAAAAGAAGTTTGGTATCAACCCCTAACAAAAATCGAAAGAGATCTATACTGAGGACGATGGTGTTGCAGTTCGTGAAGCATGAGTGCATTGAAACCGCTGTTGCCAAGGCAAAAGAGGTTCGACATCAGGCTGATAGAGTGGTGCAGCGTGGAAAAGATGGTTCACTCGCTGCAGCGAGGAGTTATGTAGAAAATAGGAAGAAACTCTTGGTTTCATTTAAATATGTATCTACATTTTTGTTTGTGCTATTGTTTAATGTTTGA

Protein Analysis

88

Amino Acids

10.15

Weight (kDa)

10.83

Isoelectric Point (pI)

49.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L17 PF01196 17 - 65 2.6e-10 Ribosomal protein L17
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 99
AgsI TTSAA 1 cut(s) 95
AjuI GAANNNNNNNTTGG 3 cut(s) 28, 194, 226
ApeKI GCWGC 3 cut(s) 148, 173, 176
BbvI GCAGC 3 cut(s) 160, 160, 188
BccI CCATC 2 cut(s) 55, 155
BcgI CGANNNNNNTGC 2 cut(s) 49, 83
BfmI CTRYAG 1 cut(s) 174
BglII AGATCT 1 cut(s) 44
BisI GCNGC 3 cut(s) 149, 174, 177
BlsI GCNGC 3 cut(s) 150, 175, 178
BsaJI CCNNGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 196
BseXI GCAGC 3 cut(s) 160, 160, 188
BsgI GTGCAG 1 cut(s) 167
Bsp143I GATC 1 cut(s) 44
BspACI CCGC 1 cut(s) 99
BspCNI CTCAG 1 cut(s) 45
BspMAI CTGCAG 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 44
BssT1I CCWWGG 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 53
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 174
BstV1I GCAGC 3 cut(s) 160, 160, 188
BstX2I RGATCY 1 cut(s) 44
BstYI RGATCY 1 cut(s) 44
CviAII CATG 1 cut(s) 83
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
DdeI CTNAG 1 cut(s) 53
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
DraI TTTAAA 1 cut(s) 223
Eco130I CCWWGG 1 cut(s) 108
EcoT14I CCWWGG 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 108
FaeI CATG 1 cut(s) 86
FaiI YATR 4 cut(s) 50, 84, 189, 228
FalI AAGNNNNNCTT 2 cut(s) 194, 226
FatI CATG 1 cut(s) 82
Fnu4HI GCNGC 3 cut(s) 149, 174, 177
Fsp4HI GCNGC 3 cut(s) 149, 174, 177
GluI GCNGC 3 cut(s) 149, 174, 177
Hin1II CATG 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 167
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 167
HpyCH4V TGCA 4 cut(s) 70, 90, 148, 176
HpyF3I CTNAG 1 cut(s) 53
Hsp92II CATG 1 cut(s) 86
Kzo9I GATC 1 cut(s) 44
LpnPI CCDG 1 cut(s) 116
Lsp1109I GCAGC 3 cut(s) 160, 160, 188
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MboII GAAGA 1 cut(s) 214
MflI RGATCY 1 cut(s) 44
MnlI CCTC 3 cut(s) 48, 112, 174
MseI TTAA 2 cut(s) 222, 258
MspA1I CMGCKG 1 cut(s) 101
NdeII GATC 1 cut(s) 44
NlaIII CATG 1 cut(s) 86
PkrI GCNGC 3 cut(s) 150, 175, 178
PstI CTGCAG 1 cut(s) 178
PsuI RGATCY 1 cut(s) 44
SaqAI TTAA 2 cut(s) 222, 258
SatI GCNGC 3 cut(s) 149, 174, 177
Sau3AI GATC 1 cut(s) 44
SetI ASST 1 cut(s) 123
SfcI CTRYAG 1 cut(s) 174
SgeI CNNG 8 cut(s) 88, 95, 121, 143, 164, 182, 192, 223
SmiI ATTTAAAT 1 cut(s) 223
SsiI CCGC 1 cut(s) 99
StyI CCWWGG 1 cut(s) 108
SwaI ATTTAAAT 1 cut(s) 223
TaqI TCGA 2 cut(s) 37, 124
Tru1I TTAA 2 cut(s) 222, 258
Tru9I TTAA 2 cut(s) 222, 258
TseI GCWGC 3 cut(s) 148, 173, 176
TspDTI ATGAA 2 cut(s) 17, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.