Rmu_sc0005837.1_g000005

Belongs to the bacterial ribosomal protein bL17 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005837.1
Physical Location & Seq
Reverse (-)
22929 .. 23269
341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005837.1_g000005.1.cds

Sequence Viewer

Length: 204 bp
atgctgatgtggacacaggtgtcgcagttggtgaagatcgaacgcattgaaaccacggttgccaaggcaaaagaggttcgacgtcaggttgatagaatggtgcagcttggaaaagacggttcactctgtgctgcaaggcgtgctgctgcttttgctcgtagggatgctgtaattcacaagctattcacagaactggcctattga

Protein Analysis

67

Amino Acids

7.68

Weight (kDa)

10.27

Isoelectric Point (pI)

49.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 19
AatII GACGTC 1 cut(s) 85
AcyI GRCGYC 1 cut(s) 82
AdeI CACNNNGTG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 50
AluBI AGCT 2 cut(s) 106, 181
AluI AGCT 2 cut(s) 106, 181
AoxI GGCC 1 cut(s) 195
ApeKI GCWGC 4 cut(s) 103, 131, 143, 146
AsuHPI GGTGA 1 cut(s) 43
BbvI GCAGC 4 cut(s) 115, 118, 130, 133
BisI GCNGC 4 cut(s) 104, 132, 144, 147
BlsI GCNGC 4 cut(s) 105, 133, 145, 148
BmsI GCATC 1 cut(s) 154
BsaHI GRCGYC 1 cut(s) 82
BsaJI CCNNGG 2 cut(s) 54, 63
Bse1I ACTGG 1 cut(s) 198
BseDI CCNNGG 2 cut(s) 54, 63
BseGI GGATG 1 cut(s) 169
BseNI ACTGG 1 cut(s) 198
BseXI GCAGC 4 cut(s) 115, 118, 130, 133
BsgI GTGCAG 1 cut(s) 122
BshFI GGCC 1 cut(s) 197
BsnI GGCC 1 cut(s) 197
Bsp143I GATC 1 cut(s) 36
BspANI GGCC 1 cut(s) 197
BsrI ACTGG 1 cut(s) 198
BssECI CCNNGG 2 cut(s) 54, 63
BssMI GATC 1 cut(s) 36
BssNI GRCGYC 1 cut(s) 82
BssT1I CCWWGG 1 cut(s) 63
Bst4CI ACNGT 2 cut(s) 58, 119
BstACI GRCGYC 1 cut(s) 82
BstAPI GCANNNNNTGC 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 141
BstDSI CCRYGG 1 cut(s) 54
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstMWI GCNNNNNNNGC 2 cut(s) 140, 152
BstV1I GCAGC 4 cut(s) 115, 118, 130, 133
BsuRI GGCC 1 cut(s) 197
BtgI CCRYGG 1 cut(s) 54
BtsCI GGATG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 141
CviJI RGCY 3 cut(s) 106, 181, 197
CviKI_1 RGCY 3 cut(s) 106, 181, 197
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
DraIII CACNNNGTG 1 cut(s) 128
DrdI GACNNNNNNGTC 1 cut(s) 19
DseDI GACNNNNNNGTC 1 cut(s) 19
Eco130I CCWWGG 1 cut(s) 63
EcoT14I CCWWGG 1 cut(s) 63
ErhI CCWWGG 1 cut(s) 63
Fnu4HI GCNGC 4 cut(s) 104, 132, 144, 147
FokI GGATG 1 cut(s) 176
Fsp4HI GCNGC 4 cut(s) 104, 132, 144, 147
GluI GCNGC 4 cut(s) 104, 132, 144, 147
HaeIII GGCC 1 cut(s) 197
Hin1I GRCGYC 1 cut(s) 82
HphI GGTGA 1 cut(s) 43
Hpy166II GTNNAC 2 cut(s) 12, 122
Hpy8I GTNNAC 2 cut(s) 12, 122
Hpy99I CGWCG 1 cut(s) 84
HpyCH4III ACNGT 2 cut(s) 58, 119
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 2 cut(s) 103, 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 140, 152
HpySE526I ACGT 1 cut(s) 82
Hsp92I GRCGYC 1 cut(s) 82
Kzo9I GATC 1 cut(s) 36
LpnPI CCDG 3 cut(s) 2, 71, 179
Lsp1109I GCAGC 4 cut(s) 115, 118, 130, 133
LweI GCATC 1 cut(s) 154
MaeII ACGT 1 cut(s) 82
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MboII GAAGA 1 cut(s) 46
MluCI AATT 1 cut(s) 171
MnlI CCTC 1 cut(s) 67
MwoI GCNNNNNNNGC 2 cut(s) 140, 152
NdeII GATC 1 cut(s) 36
PkrI GCNGC 4 cut(s) 105, 133, 145, 148
SatI GCNGC 4 cut(s) 104, 132, 144, 147
Sau3AI GATC 1 cut(s) 36
SetI ASST 6 cut(s) 21, 78, 85, 90, 108, 183
SfaNI GCATC 1 cut(s) 154
SgeI CNNG 9 cut(s) 29, 67, 76, 98, 119, 147, 152, 168, 190
Sse9I AATT 1 cut(s) 171
StyI CCWWGG 1 cut(s) 63
TaaI ACNGT 2 cut(s) 58, 119
TaiI ACGT 1 cut(s) 85
TaqI TCGA 2 cut(s) 39, 79
TasI AATT 1 cut(s) 171
TseI GCWGC 4 cut(s) 103, 131, 143, 146
ZraI GACGTC 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.