RchiOBHm_Chr2g0129011

RNA polymerase Rpb1, domain 5

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
44534071 .. 44534259
189 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50070

Sequence Viewer

Length: 189 bp
ATGGCCCTTCAACAAAGAGTATTGATAAGATTACAAGGAGCAAACAAGATGACTAGCAAAAGAAGTAATGAAACTTCTTGGGTCGTAATTGCTATTTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTTGAATATGTCCTTGAATTCCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

62

Amino Acids

6.99

Weight (kDa)

9.69

Isoelectric Point (pI)

48.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017493)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 157, 179
AfiI CCNNNNNNNGG 1 cut(s) 149
AgsI TTSAA 3 cut(s) 11, 167, 179
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 157, 179
AspS9I GGNCC 1 cut(s) 4
BarI GAAGNNNNNNTAC 2 cut(s) 58, 90
BfaI CTAG 1 cut(s) 54
BmgT120I GGNCC 1 cut(s) 4
Bsc4I CCNNNNNNNGG 1 cut(s) 149
BseLI CCNNNNNNNGG 1 cut(s) 149
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 149
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 152
BstMWI GCNNNNNNNGC 1 cut(s) 116
BsuRI GGCC 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 3 cut(s) 5, 110, 119
CviKI_1 RGCY 3 cut(s) 5, 110, 119
EcoRI GAATTC 1 cut(s) 179
FaiI YATR 2 cut(s) 116, 171
FspBI CTAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 5
Hpy188I TCNGA 1 cut(s) 156
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
LmnI GCTCC 1 cut(s) 38
MaeI CTAG 1 cut(s) 54
MluCI AATT 3 cut(s) 87, 157, 179
MwoI GCNNNNNNNGC 1 cut(s) 116
PspPI GGNCC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 4
SetI ASST 2 cut(s) 106, 121
SgeI CNNG 4 cut(s) 47, 58, 66, 90
Sse9I AATT 3 cut(s) 87, 157, 179
SspMI CTAG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 152
TasI AATT 3 cut(s) 87, 157, 179
TspDTI ATGAA 1 cut(s) 84
XapI RAATTY 2 cut(s) 157, 179
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.