RchiOBHm_Chr3g0459441

Diacylglycerol kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
7871676 .. 7873696
2021 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42603

Sequence Viewer

Length: 273 bp
ATGAAAACTGACAGCTGGCATATTCTCATTGGGATGAAAACCACTAAAATTTCTACAGCTAATCAACAAATACCTCATTCTTTGCATCTATGTCTTCCAGTTCATGAAGCTCATGTCAAAATGCGATCAAAACATGCAAGCCTTCAAGGAAGTGGCCATCATAAGGCATCCACGTATTGGAGAATATGCATTTGGGTTCATTACTTCATCCTTCAGGATCCAAACTATTTATTCACTGGCTTCCTTCCATATTTGATGATTCAGCTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.51

Weight (kDa)

9.52

Isoelectric Point (pI)

52.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 177
AclWI GGATC 2 cut(s) 212, 225
AcoI YGGCCR 1 cut(s) 154
AcsI RAATTY 1 cut(s) 48
AcuI CTGAAG 1 cut(s) 197
AfiI CCNNNNNNNGG 2 cut(s) 163, 177
AgsI TTSAA 1 cut(s) 146
AjuI GAANNNNNNNTTGG 2 cut(s) 175, 207
AluBI AGCT 4 cut(s) 15, 59, 110, 265
AluI AGCT 4 cut(s) 15, 59, 110, 265
AlwI GGATC 2 cut(s) 212, 225
AoxI GGCC 1 cut(s) 154
ApoI RAATTY 1 cut(s) 48
BalI TGGCCA 1 cut(s) 156
BamHI GGATCC 1 cut(s) 217
BbsI GAAGAC 1 cut(s) 86
BccI CCATC 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 54
BmiI GGNNCC 1 cut(s) 219
BmsI GCATC 2 cut(s) 94, 176
BpiI GAAGAC 1 cut(s) 86
BsaAI YACGTR 1 cut(s) 174
Bsc4I CCNNNNNNNGG 2 cut(s) 163, 177
Bse1I ACTGG 2 cut(s) 98, 241
BseGI GGATG 3 cut(s) 39, 167, 207
BseLI CCNNNNNNNGG 2 cut(s) 163, 177
BseNI ACTGG 2 cut(s) 98, 241
BshFI GGCC 1 cut(s) 156
BslI CCNNNNNNNGG 2 cut(s) 163, 177
BsnI GGCC 1 cut(s) 156
Bsp143I GATC 2 cut(s) 125, 217
BspANI GGCC 1 cut(s) 156
BspHI TCATGA 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 219
BspPI GGATC 2 cut(s) 212, 225
BsrI ACTGG 2 cut(s) 98, 241
BssMI GATC 2 cut(s) 125, 217
BstBAI YACGTR 1 cut(s) 174
BstC8I GCNNGC 2 cut(s) 17, 139
BstF5I GGATG 3 cut(s) 39, 167, 207
BstKTI GATC 2 cut(s) 128, 220
BstMBI GATC 2 cut(s) 125, 217
BstNSI RCATGY 1 cut(s) 137
BstSFI CTRYAG 1 cut(s) 54
BstV2I GAAGAC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 217
BstYI RGATCY 1 cut(s) 217
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 3 cut(s) 39, 167, 207
BtsIMutI CAGTG 1 cut(s) 234
Cac8I GCNNGC 2 cut(s) 17, 139
CciI TCATGA 1 cut(s) 103
CviAII CATG 3 cut(s) 104, 113, 134
CviJI RGCY 7 cut(s) 15, 59, 110, 141, 156, 240, 265
CviKI_1 RGCY 7 cut(s) 15, 59, 110, 141, 156, 240, 265
DpnI GATC 2 cut(s) 127, 219
DpnII GATC 2 cut(s) 125, 217
EaeI YGGCCR 1 cut(s) 154
Eco57I CTGAAG 1 cut(s) 197
EcoT22I ATGCAT 1 cut(s) 191
FaeI CATG 3 cut(s) 107, 116, 137
FaiI YATR 8 cut(s) 21, 91, 105, 114, 135, 162, 187, 250
FatI CATG 3 cut(s) 103, 112, 133
FokI GGATG 3 cut(s) 46, 154, 194
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 3 cut(s) 107, 116, 137
HinfI GANTC 1 cut(s) 259
Hpy188III TCNNGA 2 cut(s) 104, 215
HpyAV CCTTC 3 cut(s) 152, 221, 254
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 85, 137, 189
HpySE526I ACGT 1 cut(s) 173
Hsp92II CATG 3 cut(s) 107, 116, 137
Kzo9I GATC 2 cut(s) 125, 217
LpnPI CCDG 3 cut(s) 111, 200, 222
LweI GCATC 2 cut(s) 94, 176
MaeII ACGT 1 cut(s) 173
MalI GATC 2 cut(s) 127, 219
MboI GATC 2 cut(s) 125, 217
MboII GAAGA 1 cut(s) 86
MflI RGATCY 1 cut(s) 217
MlsI TGGCCA 1 cut(s) 156
MluCI AATT 2 cut(s) 48, 268
MluNI TGGCCA 1 cut(s) 156
MnlI CCTC 1 cut(s) 84
Mox20I TGGCCA 1 cut(s) 156
Mph1103I ATGCAT 1 cut(s) 191
MscI TGGCCA 1 cut(s) 156
MseI TTAA 1 cut(s) 271
MslI CAYNNNNRTG 1 cut(s) 32
Msp20I TGGCCA 1 cut(s) 156
MspA1I CMGCKG 1 cut(s) 15
NdeII GATC 2 cut(s) 125, 217
NlaIII CATG 3 cut(s) 107, 116, 137
NlaIV GGNNCC 1 cut(s) 219
NsiI ATGCAT 1 cut(s) 191
NspI RCATGY 1 cut(s) 137
PagI TCATGA 1 cut(s) 103
PfeI GAWTC 1 cut(s) 259
PflMI CCANNNNNTGG 1 cut(s) 177
Ppu21I YACGTR 1 cut(s) 174
PspN4I GGNNCC 1 cut(s) 219
PsuI RGATCY 1 cut(s) 217
PvuII CAGCTG 1 cut(s) 15
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 271
Sau3AI GATC 2 cut(s) 125, 217
SetI ASST 6 cut(s) 17, 61, 76, 112, 176, 267
SfaNI GCATC 2 cut(s) 94, 176
SfcI CTRYAG 1 cut(s) 54
SmiMI CAYNNNNRTG 1 cut(s) 32
Sse9I AATT 2 cut(s) 48, 268
TaiI ACGT 1 cut(s) 176
TasI AATT 2 cut(s) 48, 268
TfiI GAWTC 1 cut(s) 259
Tru1I TTAA 1 cut(s) 271
Tru9I TTAA 1 cut(s) 271
TscAI CASTG 1 cut(s) 241
TspDTI ATGAA 6 cut(s) 17, 50, 92, 120, 188, 196
TspRI CASTG 1 cut(s) 241
Van91I CCANNNNNTGG 1 cut(s) 177
XapI RAATTY 1 cut(s) 48
XceI RCATGY 1 cut(s) 137
Zsp2I ATGCAT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.