Rw7G032810

Diacylglycerol kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0016350
Physical Location & Seq
Reverse (-)
48056020 .. 48056877
858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G032810.1

Sequence Viewer

Length: 342 bp
ATGAAAACTGACAGCTGGCATATTCTCATTGGGATGAAAACCACTAAAAGTTCTACAGCTAATCAACAAATACCTCATTCTTTGCATCTATGTCTTCCAGTTCATGAAGCTCATGTCAAAATGCGATCAAAACATGCAAGCCTTCAAGGAAGTGGCCATCATAAGGCATCCACGTATTGGAGAATATGCATTTGGGTTCATTACTTCATCAGTTACCCTTCAGGATCCAAACTATTTATTCACTGGCTTCCTTCCATATTTGATGATTCAGCTAAATTAAAATTATGCTGGAGCTTAAAATTATCACAACCAAAGTTCGCAGCCAACCAAGCAAGCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DAGK_acc DAGK_cat NB-ARC

Protein Analysis

113

Amino Acids

12.95

Weight (kDa)

9.91

Isoelectric Point (pI)

52.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 177
AclWI GGATC 2 cut(s) 219, 232
AcoI YGGCCR 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 204
AfiI CCNNNNNNNGG 2 cut(s) 163, 177
AgsI TTSAA 1 cut(s) 146
AjuI GAANNNNNNNTTGG 2 cut(s) 175, 207
AluBI AGCT 5 cut(s) 15, 59, 110, 272, 294
AluI AGCT 5 cut(s) 15, 59, 110, 272, 294
AlwI GGATC 2 cut(s) 219, 232
AoxI GGCC 1 cut(s) 154
ApeKI GCWGC 1 cut(s) 320
BalI TGGCCA 1 cut(s) 156
BamHI GGATCC 1 cut(s) 224
BbsI GAAGAC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 332
BccI CCATC 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 54
BisI GCNGC 1 cut(s) 321
BlsI GCNGC 1 cut(s) 322
BmiI GGNNCC 1 cut(s) 226
BmsI GCATC 2 cut(s) 94, 176
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 310
BsaAI YACGTR 1 cut(s) 174
Bsc4I CCNNNNNNNGG 2 cut(s) 163, 177
Bse1I ACTGG 2 cut(s) 98, 248
BseGI GGATG 2 cut(s) 39, 167
BseLI CCNNNNNNNGG 2 cut(s) 163, 177
BseNI ACTGG 2 cut(s) 98, 248
BseXI GCAGC 1 cut(s) 332
BshFI GGCC 1 cut(s) 156
BslI CCNNNNNNNGG 2 cut(s) 163, 177
BsnI GGCC 1 cut(s) 156
Bsp143I GATC 2 cut(s) 125, 224
BspANI GGCC 1 cut(s) 156
BspHI TCATGA 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 226
BspPI GGATC 2 cut(s) 219, 232
BsrI ACTGG 2 cut(s) 98, 248
BssMI GATC 2 cut(s) 125, 224
BstBAI YACGTR 1 cut(s) 174
BstC8I GCNNGC 3 cut(s) 17, 139, 334
BstF5I GGATG 2 cut(s) 39, 167
BstKTI GATC 2 cut(s) 128, 227
BstMBI GATC 2 cut(s) 125, 224
BstMWI GCNNNNNNNGC 1 cut(s) 329
BstNSI RCATGY 1 cut(s) 137
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 1 cut(s) 332
BstV2I GAAGAC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 224
BstYI RGATCY 1 cut(s) 224
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 2 cut(s) 39, 167
BtsIMutI CAGTG 1 cut(s) 241
Cac8I GCNNGC 3 cut(s) 17, 139, 334
CciI TCATGA 1 cut(s) 103
CviAII CATG 3 cut(s) 104, 113, 134
CviJI RGCY 9 cut(s) 15, 59, 110, 141, 156, 247, 272, 294, 323
CviKI_1 RGCY 9 cut(s) 15, 59, 110, 141, 156, 247, 272, 294, 323
DpnI GATC 2 cut(s) 127, 226
DpnII GATC 2 cut(s) 125, 224
EaeI YGGCCR 1 cut(s) 154
Eco57I CTGAAG 1 cut(s) 204
EcoT22I ATGCAT 1 cut(s) 191
FaeI CATG 3 cut(s) 107, 116, 137
FaiI YATR 9 cut(s) 21, 91, 105, 114, 135, 162, 187, 257, 286
FatI CATG 3 cut(s) 103, 112, 133
Fnu4HI GCNGC 1 cut(s) 321
FokI GGATG 2 cut(s) 46, 154
Fsp4HI GCNGC 1 cut(s) 321
GluI GCNGC 1 cut(s) 321
GsuI CTGGAG 1 cut(s) 310
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 3 cut(s) 107, 116, 137
HinfI GANTC 1 cut(s) 266
Hpy188III TCNNGA 2 cut(s) 104, 222
HpyAV CCTTC 3 cut(s) 152, 228, 261
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 85, 137, 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 329
HpySE526I ACGT 1 cut(s) 173
Hsp92II CATG 3 cut(s) 107, 116, 137
Kzo9I GATC 2 cut(s) 125, 224
LmnI GCTCC 1 cut(s) 291
LpnPI CCDG 4 cut(s) 111, 207, 229, 274
Lsp1109I GCAGC 1 cut(s) 332
LweI GCATC 2 cut(s) 94, 176
MaeII ACGT 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 212
MalI GATC 2 cut(s) 127, 226
MboI GATC 2 cut(s) 125, 224
MboII GAAGA 1 cut(s) 86
MflI RGATCY 1 cut(s) 224
MlsI TGGCCA 1 cut(s) 156
MluCI AATT 3 cut(s) 275, 281, 299
MluNI TGGCCA 1 cut(s) 156
MnlI CCTC 1 cut(s) 84
Mox20I TGGCCA 1 cut(s) 156
Mph1103I ATGCAT 1 cut(s) 191
MscI TGGCCA 1 cut(s) 156
MseI TTAA 2 cut(s) 278, 296
MslI CAYNNNNRTG 1 cut(s) 32
Msp20I TGGCCA 1 cut(s) 156
MspA1I CMGCKG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 329
NdeII GATC 2 cut(s) 125, 224
NlaIII CATG 3 cut(s) 107, 116, 137
NlaIV GGNNCC 1 cut(s) 226
NsiI ATGCAT 1 cut(s) 191
NspI RCATGY 1 cut(s) 137
PagI TCATGA 1 cut(s) 103
PfeI GAWTC 1 cut(s) 266
PflMI CCANNNNNTGG 1 cut(s) 177
PkrI GCNGC 1 cut(s) 322
Ppu21I YACGTR 1 cut(s) 174
PspN4I GGNNCC 1 cut(s) 226
PsuI RGATCY 1 cut(s) 224
PvuII CAGCTG 1 cut(s) 15
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 2 cut(s) 278, 296
SatI GCNGC 1 cut(s) 321
Sau3AI GATC 2 cut(s) 125, 224
SetI ASST 7 cut(s) 17, 61, 76, 112, 176, 274, 296
SfaNI GCATC 2 cut(s) 94, 176
SfcI CTRYAG 1 cut(s) 54
SmiMI CAYNNNNRTG 1 cut(s) 32
Sse9I AATT 3 cut(s) 275, 281, 299
TaiI ACGT 1 cut(s) 176
TasI AATT 3 cut(s) 275, 281, 299
TfiI GAWTC 1 cut(s) 266
Tru1I TTAA 2 cut(s) 278, 296
Tru9I TTAA 2 cut(s) 278, 296
TscAI CASTG 1 cut(s) 248
TseI GCWGC 1 cut(s) 320
TspDTI ATGAA 6 cut(s) 17, 50, 92, 120, 188, 196
TspRI CASTG 1 cut(s) 248
Van91I CCANNNNNTGG 1 cut(s) 177
XceI RCATGY 1 cut(s) 137
Zsp2I ATGCAT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.