RchiOBHm_Chr4g0423021

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
48581611 .. 48584461
2851 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39245

Sequence Viewer

Length: 333 bp
ATGTTTGTTCTTGGGTGGGAAATAGATTTGTTTAATGAAGTACTAGACTTGGTTATCTATTTCCTCACTCTCACATGTGTATCTAGTTTCTGTGTTTTTAGATTTGAGCGTGAGGTCCAATTGATGAAAAATCTCTTGGAAGGCTATAGGAAAGCTTTAAAGGCAACACAAAAGACATTTGCTGAACATACAGCACATTGTCCACAGGCTGTTGAGCCATTTTGCAGGGATAGATGTTTCGGGATTGGGGGCCTTGTTTTAAGCACCACAGAACTGGAAAAGCTACGCCTAAAGCAAGAAGAAGAAGAGAGGATGAACAAGACTGGTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.81

Weight (kDa)

5.44

Isoelectric Point (pI)

31.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 42
AflIII ACRYGT 1 cut(s) 74
AjuI GAANNNNNNNTTGG 2 cut(s) 119, 151
AluBI AGCT 2 cut(s) 155, 283
AluI AGCT 2 cut(s) 155, 283
AoxI GGCC 1 cut(s) 250
AspS9I GGNCC 2 cut(s) 115, 250
AvaII GGWCC 1 cut(s) 115
BaeI ACNNNNGTAYC 2 cut(s) 63, 96
BfaI CTAG 2 cut(s) 44, 84
BfmI CTRYAG 1 cut(s) 145
BmcAI AGTACT 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 2 cut(s) 115, 250
BmiI GGNNCC 1 cut(s) 251
Bse1I ACTGG 2 cut(s) 279, 328
BseGI GGATG 1 cut(s) 318
BseNI ACTGG 2 cut(s) 279, 328
BshFI GGCC 1 cut(s) 252
BsnI GGCC 1 cut(s) 252
BspANI GGCC 1 cut(s) 252
BspLI GGNNCC 1 cut(s) 251
BsrI ACTGG 2 cut(s) 279, 328
Bst6I CTCTTC 1 cut(s) 300
BstF5I GGATG 1 cut(s) 318
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstNSI RCATGY 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 145
BstXI CCANNNNNNTGG 1 cut(s) 274
BsuRI GGCC 1 cut(s) 252
BtsCI GGATG 1 cut(s) 318
Cfr13I GGNCC 2 cut(s) 115, 250
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 75
CviJI RGCY 6 cut(s) 144, 155, 209, 217, 252, 283
CviKI_1 RGCY 6 cut(s) 144, 155, 209, 217, 252, 283
CviQI GTAC 1 cut(s) 41
DraI TTTAAA 1 cut(s) 159
Eam1104I CTCTTC 1 cut(s) 300
EarI CTCTTC 1 cut(s) 300
Eco47I GGWCC 1 cut(s) 115
EcoO109I RGGNCCY 1 cut(s) 250
FaeI CATG 1 cut(s) 78
FaiI YATR 3 cut(s) 76, 147, 189
FatI CATG 1 cut(s) 74
FokI GGATG 1 cut(s) 325
FspBI CTAG 2 cut(s) 44, 84
HaeIII GGCC 1 cut(s) 252
Hin1II CATG 1 cut(s) 78
HindIII AAGCTT 1 cut(s) 153
Hpy166II GTNNAC 1 cut(s) 203
Hpy188III TCNNGA 1 cut(s) 241
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
Hsp92II CATG 1 cut(s) 78
LpnPI CCDG 4 cut(s) 191, 211, 260, 309
MaeI CTAG 2 cut(s) 44, 84
MboII GAAGA 3 cut(s) 311, 314, 317
MfeI CAATTG 1 cut(s) 119
MluCI AATT 1 cut(s) 119
MnlI CCTC 3 cut(s) 74, 106, 303
MseI TTAA 3 cut(s) 33, 158, 260
MunI CAATTG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 161
NlaIII CATG 1 cut(s) 78
NlaIV GGNNCC 1 cut(s) 251
NspI RCATGY 1 cut(s) 78
PciI ACATGT 1 cut(s) 74
PscI ACATGT 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 251
PspPI GGNCC 2 cut(s) 115, 250
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
SaqAI TTAA 3 cut(s) 33, 158, 260
Sau96I GGNCC 2 cut(s) 115, 250
ScaI AGTACT 1 cut(s) 42
SetI ASST 3 cut(s) 117, 157, 285
SfcI CTRYAG 1 cut(s) 145
SinI GGWCC 1 cut(s) 115
Sse9I AATT 1 cut(s) 119
SspMI CTAG 2 cut(s) 44, 84
TasI AATT 1 cut(s) 119
TatI WGTACW 1 cut(s) 40
Tru1I TTAA 3 cut(s) 33, 158, 260
Tru9I TTAA 3 cut(s) 33, 158, 260
TspDTI ATGAA 3 cut(s) 51, 140, 329
VpaK11BI GGWCC 1 cut(s) 115
XceI RCATGY 1 cut(s) 78
XspI CTAG 2 cut(s) 44, 84
ZrmI AGTACT 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.