Rh2BG383200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
54303294 .. 54304070
777 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG383200.1

Sequence Viewer

Length: 357 bp
ATGTCCAGCGATTCAAATCTGTCGAAGCTTCACCATCTGATTGATGATTCTCTCCATCCTTACCCAGAACCAGATGTTGTTTGGGTGACCAAAGAGAGAGAAATTTGGGTTAGTCTCTCTCAGGTACTTCGATTTGAGCGTGAGGTCCAATTGATGAAAAATCTCTTGGAAGGCTATAGGAAAGCTTTAAAGGCAACACAAAAGACATTTGCTGAACATAAAGCACATTGTCCACAGGCTATTGAGCCACTTTGCAGGGATAGATGTTTCGGGATCGGGGGGCCTTGTTTTAAGCACCACAGAACTGGAAAAGCTACGCCTAAAGCAAGAAGAAGAAGAGAGGATGAACAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.78

Weight (kDa)

8.98

Isoelectric Point (pI)

45.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 281
AcsI RAATTY 1 cut(s) 102
AfaI GTAC 1 cut(s) 126
AgsI TTSAA 1 cut(s) 15
AjuI GAANNNNNNNTTGG 2 cut(s) 149, 181
AluBI AGCT 3 cut(s) 28, 185, 314
AluI AGCT 3 cut(s) 28, 185, 314
Alw26I GTCTC 1 cut(s) 119
AlwI GGATC 1 cut(s) 281
AoxI GGCC 1 cut(s) 281
ApoI RAATTY 1 cut(s) 102
AspS9I GGNCC 2 cut(s) 145, 281
AsuHPI GGTGA 2 cut(s) 23, 97
AvaII GGWCC 1 cut(s) 145
BccI CCATC 2 cut(s) 42, 63
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 1 cut(s) 355
BfmI CTRYAG 1 cut(s) 175
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 2 cut(s) 145, 281
BmiI GGNNCC 1 cut(s) 282
BsaBI GATNNNNATC 1 cut(s) 15
Bse1I ACTGG 1 cut(s) 310
Bse8I GATNNNNATC 1 cut(s) 15
BseGI GGATG 2 cut(s) 55, 349
BseJI GATNNNNATC 1 cut(s) 15
BseMII CTCAG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 310
BshFI GGCC 1 cut(s) 283
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 283
Bsp143I GATC 1 cut(s) 273
BspANI GGCC 1 cut(s) 283
BspCNI CTCAG 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 282
BspPI GGATC 1 cut(s) 281
BsrI ACTGG 1 cut(s) 310
BssMI GATC 1 cut(s) 273
Bst6I CTCTTC 1 cut(s) 331
BstDEI CTNAG 1 cut(s) 120
BstEII GGTNACC 1 cut(s) 85
BstF5I GGATG 2 cut(s) 55, 349
BstKTI GATC 1 cut(s) 276
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 273
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstPI GGTNACC 1 cut(s) 85
BstSFI CTRYAG 1 cut(s) 175
BstXI CCANNNNNNTGG 1 cut(s) 305
BsuRI GGCC 1 cut(s) 283
BtsCI GGATG 2 cut(s) 55, 349
Cfr13I GGNCC 2 cut(s) 145, 281
Csp6I GTAC 1 cut(s) 125
CviJI RGCY 7 cut(s) 28, 174, 185, 239, 247, 283, 314
CviKI_1 RGCY 7 cut(s) 28, 174, 185, 239, 247, 283, 314
CviQI GTAC 1 cut(s) 125
DdeI CTNAG 1 cut(s) 120
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
DraI TTTAAA 1 cut(s) 189
Eam1104I CTCTTC 1 cut(s) 331
EarI CTCTTC 1 cut(s) 331
Eco47I GGWCC 1 cut(s) 145
Eco91I GGTNACC 1 cut(s) 85
EcoO109I RGGNCCY 1 cut(s) 281
EcoO65I GGTNACC 1 cut(s) 85
FaiI YATR 2 cut(s) 177, 219
FokI GGATG 1 cut(s) 42
FspBI CTAG 1 cut(s) 355
HaeIII GGCC 1 cut(s) 283
HindIII AAGCTT 2 cut(s) 26, 183
HinfI GANTC 2 cut(s) 11, 47
HphI GGTGA 2 cut(s) 23, 97
Hpy166II GTNNAC 1 cut(s) 233
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 271
Hpy8I GTNNAC 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 164
HpyCH4V TGCA 1 cut(s) 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 1 cut(s) 120
Kzo9I GATC 1 cut(s) 273
LpnPI CCDG 7 cut(s) 19, 78, 84, 107, 221, 241, 291
MaeI CTAG 1 cut(s) 355
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MboII GAAGA 3 cut(s) 342, 345, 348
MfeI CAATTG 1 cut(s) 149
MluCI AATT 2 cut(s) 102, 149
MnlI CCTC 2 cut(s) 136, 334
MseI TTAA 2 cut(s) 188, 291
MunI CAATTG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 1 cut(s) 273
NlaIV GGNNCC 1 cut(s) 282
NmuCI GTSAC 1 cut(s) 85
PcsI WCGNNNNNNNCGW 1 cut(s) 136
PfeI GAWTC 2 cut(s) 11, 47
PspEI GGTNACC 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 282
PspPI GGNCC 2 cut(s) 145, 281
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
SaqAI TTAA 2 cut(s) 188, 291
Sau3AI GATC 1 cut(s) 273
Sau96I GGNCC 2 cut(s) 145, 281
SetI ASST 5 cut(s) 30, 126, 147, 187, 316
SfcI CTRYAG 1 cut(s) 175
SinI GGWCC 1 cut(s) 145
Sse9I AATT 2 cut(s) 102, 149
SspMI CTAG 1 cut(s) 355
TaqI TCGA 2 cut(s) 23, 130
TasI AATT 2 cut(s) 102, 149
TfiI GAWTC 2 cut(s) 11, 47
Tru1I TTAA 2 cut(s) 188, 291
Tru9I TTAA 2 cut(s) 188, 291
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 170
VpaK11BI GGWCC 1 cut(s) 145
XapI RAATTY 1 cut(s) 102
XcmI CCANNNNNNNNNTGG 1 cut(s) 78
XspI CTAG 1 cut(s) 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.