Rh4BG253000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
42375464 .. 42377355
1892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG253000.1

Sequence Viewer

Length: 237 bp
ATGGAGATCCCCTATTGCATTGTGAAGGGCAAAGCACGTTTGGGAGCGTTAAAATTTTGCCAATCCAATTCAACACAGACTCAGTCCGTCTCATACTTCATTTGCACACCATATATACTCACAGAACCAGATGTCGTTTGGGTGACCAAAGACACAGAAATTTGGGTTAGTCTCTCTCAGGTACTTCGGCAAGTAAAGCATTGGATTGGAGAAGTTGATTCGATTATGATAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.95

Weight (kDa)

6.53

Isoelectric Point (pI)

29.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 53, 159
AfaI GTAC 1 cut(s) 183
AgsI TTSAA 1 cut(s) 72
Alw26I GTCTC 2 cut(s) 94, 176
ApoI RAATTY 2 cut(s) 53, 159
AsuHPI GGTGA 1 cut(s) 154
BcoDI GTCTC 2 cut(s) 94, 176
BseMII CTCAG 2 cut(s) 95, 191
BsmAI GTCTC 2 cut(s) 94, 176
BsmBI CGTCTC 1 cut(s) 94
Bsp143I GATC 1 cut(s) 6
BspCNI CTCAG 2 cut(s) 94, 190
BssMI GATC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 81, 177
BstEII GGTNACC 1 cut(s) 142
BstKTI GATC 1 cut(s) 9
BstMAI GTCTC 2 cut(s) 94, 176
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstPI GGTNACC 1 cut(s) 142
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
Csp6I GTAC 1 cut(s) 182
CviQI GTAC 1 cut(s) 182
DdeI CTNAG 2 cut(s) 81, 177
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eco91I GGTNACC 1 cut(s) 142
EcoO65I GGTNACC 1 cut(s) 142
Esp3I CGTCTC 1 cut(s) 94
FaiI YATR 5 cut(s) 94, 112, 114, 116, 227
HinfI GANTC 2 cut(s) 79, 218
HphI GGTGA 1 cut(s) 154
HpyAV CCTTC 1 cut(s) 19
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 2 cut(s) 18, 105
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
HpyF3I CTNAG 2 cut(s) 81, 177
HpySE526I ACGT 1 cut(s) 37
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 2 cut(s) 141, 164
MaeII ACGT 1 cut(s) 37
MaeIII GTNAC 1 cut(s) 142
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MflI RGATCY 1 cut(s) 6
MluCI AATT 3 cut(s) 53, 67, 159
MlyI GAGTC 1 cut(s) 73
MseI TTAA 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 196
NdeII GATC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 218
PflFI GACNNNGTC 1 cut(s) 82
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PspEI GGTNACC 1 cut(s) 142
PsuI RGATCY 1 cut(s) 6
PsyI GACNNNGTC 1 cut(s) 82
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 1 cut(s) 6
SchI GAGTC 1 cut(s) 73
SetI ASST 2 cut(s) 40, 183
SgeI CNNG 4 cut(s) 48, 140, 191, 203
Sse9I AATT 3 cut(s) 53, 67, 159
TaiI ACGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 221
TasI AATT 3 cut(s) 53, 67, 159
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TseFI GTSAC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 88
TspGWI ACGGA 1 cut(s) 76
Tth111I GACNNNGTC 1 cut(s) 82
XapI RAATTY 2 cut(s) 53, 159
XcmI CCANNNNNNNNNTGG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.