Rh6AG348000

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0014809
Physical Location & Seq
Reverse (-)
54817930 .. 54818419
490 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG348000.1

Sequence Viewer

Length: 216 bp
ATGATCCACATACCAGAGAGACAGCCAGTGAAGCGACCAGATTCTGATCAGGTCCCTACCATGGAGCAACTGGAAGATGTCGTTTGGGTGACCAAAGAGACAGAAATTCGGGTTATTCTCTCTCAGGTACTTCGGCAAGTAAAGCATTGGATTGGAGAAGTTGATTCCGATTATGATAATGTGAGTGTGTTTCTCTTTGAAAACTGTAAAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LINES_C LINES_N

Protein Analysis

71

Amino Acids

8.42

Weight (kDa)

5.0

Isoelectric Point (pI)

57.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 105
AfaI GTAC 1 cut(s) 129
AfiI CCNNNNNNNGG 1 cut(s) 61
AgsI TTSAA 1 cut(s) 200
Alw26I GTCTC 2 cut(s) 13, 92
AlwNI CAGNNNCTG 1 cut(s) 44
ApoI RAATTY 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 1 cut(s) 52
BclI TGATCA 1 cut(s) 46
BcoDI GTCTC 2 cut(s) 13, 92
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 54
BsaBI GATNNNNATC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 61
Bse1I ACTGG 2 cut(s) 26, 75
Bse8I GATNNNNATC 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 60
BseJI GATNNNNATC 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 2 cut(s) 26, 75
BslFI GGGAC 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 61
BsmAI GTCTC 2 cut(s) 13, 92
BsmFI GGGAC 1 cut(s) 38
Bsp143I GATC 2 cut(s) 3, 46
Bsp19I CCATGG 1 cut(s) 60
BspCNI CTCAG 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 54
BsrI ACTGG 2 cut(s) 26, 75
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 2 cut(s) 3, 46
BssT1I CCWWGG 1 cut(s) 60
Bst4CI ACNGT 1 cut(s) 206
BstDEI CTNAG 1 cut(s) 123
BstDSI CCRYGG 1 cut(s) 60
BstEII GGTNACC 1 cut(s) 88
BstKTI GATC 2 cut(s) 6, 49
BstMAI GTCTC 2 cut(s) 13, 92
BstMBI GATC 2 cut(s) 3, 46
BstMWI GCNNNNNNNGC 2 cut(s) 31, 142
BstPI GGTNACC 1 cut(s) 88
BtgI CCRYGG 1 cut(s) 60
BtsIMutI CAGTG 1 cut(s) 33
CaiI CAGNNNCTG 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 52
Csp6I GTAC 1 cut(s) 128
CviAII CATG 1 cut(s) 61
CviJI RGCY 1 cut(s) 25
CviKI_1 RGCY 1 cut(s) 25
CviQI GTAC 1 cut(s) 128
DdeI CTNAG 1 cut(s) 123
DpnI GATC 2 cut(s) 5, 48
DpnII GATC 2 cut(s) 3, 46
Eco130I CCWWGG 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 52
Eco91I GGTNACC 1 cut(s) 88
EcoO109I RGGNCCY 1 cut(s) 52
EcoO65I GGTNACC 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 1 cut(s) 64
FaiI YATR 3 cut(s) 11, 62, 174
FaqI GGGAC 1 cut(s) 38
FatI CATG 1 cut(s) 60
FbaI TGATCA 1 cut(s) 46
Hin1II CATG 1 cut(s) 64
HinfI GANTC 2 cut(s) 41, 164
HphI GGTGA 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 46, 169
HpyCH4III ACNGT 1 cut(s) 206
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 142
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 1 cut(s) 64
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 2 cut(s) 3, 46
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 6 cut(s) 27, 35, 39, 51, 56, 110
MaeIII GTNAC 1 cut(s) 88
MalI GATC 2 cut(s) 5, 48
MboI GATC 2 cut(s) 3, 46
MboII GAAGA 1 cut(s) 86
MluCI AATT 1 cut(s) 105
MwoI GCNNNNNNNGC 2 cut(s) 31, 142
NcoI CCATGG 1 cut(s) 60
NdeII GATC 2 cut(s) 3, 46
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 54
NmuCI GTSAC 1 cut(s) 88
PfeI GAWTC 2 cut(s) 41, 164
PpuMI RGGWCCY 1 cut(s) 52
Psp5II RGGWCCY 1 cut(s) 52
PspEI GGTNACC 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 52
PspPPI RGGWCCY 1 cut(s) 52
PstNI CAGNNNCTG 1 cut(s) 44
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
Sau3AI GATC 2 cut(s) 3, 46
Sau96I GGNCC 1 cut(s) 52
SetI ASST 2 cut(s) 54, 129
SgeI CNNG 9 cut(s) 26, 38, 50, 62, 73, 83, 122, 137, 149
SinI GGWCC 1 cut(s) 52
Sse9I AATT 1 cut(s) 105
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 206
TasI AATT 1 cut(s) 105
TfiI GAWTC 2 cut(s) 41, 164
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspRI CASTG 1 cut(s) 33
VpaK11BI GGWCC 1 cut(s) 52
XapI RAATTY 1 cut(s) 105
XcmI CCANNNNNNNNNTGG 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.