Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006774.1

Orthogroup ID

OG0014809

Physical Location & Seq

Genomic Coordinates Reverse (-)

49981 .. 53189

Gene Structure 3209 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006774.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

atgtgcagcgattcaaatctgacgaagcttcaccgtctgatcgacgattctctccgtcagtacacagaaccagatgtcgtttcggtagcgaaagagagagaaattctggtcagtctctctcagattcttcggcaagtgaagctctggattggagaagttgattccgattctgataatggagtggtgattggattggattttgagaatgagttggagagtcaatatgtgaagcatctggcctgcaatgttctagctgctgtgtccgaattcgtggcggcttcgcacactcgagagaatttccaaaaagccaaagagtgcttaatttcgttgaaaaattcgattgaaagtctccaccaaaagaatctatttccctacaatcctaatgctcttttgaaccgcttaatgaggtttcaggaactctgtttcgaggaggaaaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LINES_C LINES_N

Protein Analysis

146

Amino Acids

16.74

Weight (kDa)

5.09

Isoelectric Point (pI)

42.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014809)

Species	Orthologous Gene IDs
malus_domestica	MD06G1092100.v1.1 MD06G1092300.v1.1
pyrus_communis	pycom10g15780
rosa_chinensis	RchiOBHm_Chr4g0423021
rosa_laevigata	RLG00000033203
rosa_multiflora	Rmu_sc0002081.1_g000012 Rmu_sc0006774.1_g000013
rosa_rugosa	Rorug07G0146600
rosa_samantha	Rh1CG097600 Rh2AG167000 Rh2BG383200 Rh2CG172700 Rh4BG253000 Rh5AG146500 Rh6AG348000 Rh6CG120600 Rh7DG247300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	275, 397
AcsI	RAATTY	4 cut(s)	102, 266, 295, 334
AfaI	GTAC	1 cut(s)	62
AgsI	TTSAA	4 cut(s)	15, 331, 344, 394
AluBI	AGCT	3 cut(s)	28, 142, 254
AluI	AGCT	3 cut(s)	28, 142, 254
Alw26I	GTCTC	2 cut(s)	119, 353
Ama87I	CYCGRG	1 cut(s)	288
AoxI	GGCC	1 cut(s)	237
ApeKI	GCWGC	2 cut(s)	6, 254
ApoI	RAATTY	4 cut(s)	102, 266, 295, 334
AsuHPI	GGTGA	2 cut(s)	23, 196
AvaI	CYCGRG	1 cut(s)	288
BbvI	GCAGC	2 cut(s)	18, 241
BcoDI	GTCTC	2 cut(s)	119, 353
BfaI	CTAG	1 cut(s)	251
BisI	GCNGC	3 cut(s)	7, 255, 276
BlsI	GCNGC	3 cut(s)	8, 256, 277
BmeT110I	CYCGRG	1 cut(s)	288
BmsI	GCATC	1 cut(s)	241
BsaBI	GATNNNNATC	1 cut(s)	15
Bse3DI	GCAATG	1 cut(s)	250
Bse8I	GATNNNNATC	1 cut(s)	15
BseJI	GATNNNNATC	1 cut(s)	15
BseMI	GCAATG	1 cut(s)	250
BseMII	CTCAG	1 cut(s)	134
BseXI	GCAGC	2 cut(s)	18, 241
BsgI	GTGCAG	1 cut(s)	25
BshFI	GGCC	1 cut(s)	239
BsiHKCI	CYCGRG	1 cut(s)	288
BsmAI	GTCTC	2 cut(s)	119, 353
BsnI	GGCC	1 cut(s)	239
BsoBI	CYCGRG	1 cut(s)	288
Bsp143I	GATC	1 cut(s)	39
BspACI	CCGC	2 cut(s)	275, 397
BspANI	GGCC	1 cut(s)	239
BspCNI	CTCAG	1 cut(s)	133
BsrDI	GCAATG	1 cut(s)	250
BssMI	GATC	1 cut(s)	39
Bst4CI	ACNGT	1 cut(s)	35
BstC8I	GCNNGC	1 cut(s)	241
BstDEI	CTNAG	1 cut(s)	120
BstKTI	GATC	1 cut(s)	42
BstMAI	GTCTC	2 cut(s)	119, 353
BstMBI	GATC	1 cut(s)	39
BstMWI	GCNNNNNNNGC	1 cut(s)	139
BstV1I	GCAGC	2 cut(s)	18, 241
BsuRI	GGCC	1 cut(s)	239
Cac8I	GCNNGC	1 cut(s)	241
Csp6I	GTAC	1 cut(s)	61
CviJI	RGCY	6 cut(s)	28, 142, 239, 254, 278, 308
CviKI_1	RGCY	6 cut(s)	28, 142, 239, 254, 278, 308
CviQI	GTAC	1 cut(s)	61
DdeI	CTNAG	1 cut(s)	120
DpnI	GATC	1 cut(s)	41
DpnII	GATC	1 cut(s)	39
Eco88I	CYCGRG	1 cut(s)	288
EcoRI	GAATTC	1 cut(s)	266
FaiI	YATR	1 cut(s)	225
Fnu4HI	GCNGC	3 cut(s)	7, 255, 276
Fsp4HI	GCNGC	3 cut(s)	7, 255, 276
FspBI	CTAG	1 cut(s)	251
GluI	GCNGC	3 cut(s)	7, 255, 276
HaeIII	GGCC	1 cut(s)	239
HindIII	AAGCTT	1 cut(s)	26
HinfI	GANTC	7 cut(s)	11, 47, 124, 161, 167, 217, 361
HphI	GGTGA	2 cut(s)	23, 196
Hpy166II	GTNNAC	1 cut(s)	63
Hpy188I	TCNGA	6 cut(s)	21, 39, 123, 166, 172, 265
Hpy188III	TCNNGA	3 cut(s)	145, 290, 413
Hpy8I	GTNNAC	1 cut(s)	63
Hpy99I	CGWCG	1 cut(s)	47
HpyCH4III	ACNGT	1 cut(s)	35
HpyCH4V	TGCA	2 cut(s)	6, 243
HpyF10VI	GCNNNNNNNGC	1 cut(s)	139
HpyF3I	CTNAG	1 cut(s)	120
Kzo9I	GATC	1 cut(s)	39
LpnPI	CCDG	6 cut(s)	84, 92, 130, 221, 253, 398
Lsp1109I	GCAGC	2 cut(s)	18, 241
LweI	GCATC	1 cut(s)	241
MaeI	CTAG	1 cut(s)	251
MalI	GATC	1 cut(s)	41
MboI	GATC	1 cut(s)	39
MboII	GAAGA	1 cut(s)	119
MluCI	AATT	5 cut(s)	102, 266, 295, 321, 334
MlyI	GAGTC	1 cut(s)	226
MmeI	TCCRAC	1 cut(s)	192
MnlI	CCTC	3 cut(s)	399, 421, 424
MseI	TTAA	2 cut(s)	320, 401
MwoI	GCNNNNNNNGC	1 cut(s)	139
NdeII	GATC	1 cut(s)	39
PaeR7I	CTCGAG	1 cut(s)	288
PfeI	GAWTC	6 cut(s)	11, 47, 124, 161, 167, 361
PkrI	GCNGC	3 cut(s)	8, 256, 277
PleI	GAGTC	1 cut(s)	225
PpsI	GAGTC	1 cut(s)	225
RsaI	GTAC	1 cut(s)	62
RsaNI	GTAC	1 cut(s)	61
SaqAI	TTAA	2 cut(s)	320, 401
SatI	GCNGC	3 cut(s)	7, 255, 276
Sau3AI	GATC	1 cut(s)	39
SchI	GAGTC	1 cut(s)	226
SetI	ASST	4 cut(s)	30, 144, 256, 410
SfaNI	GCATC	1 cut(s)	241
Sfr274I	CTCGAG	1 cut(s)	288
SlaI	CTCGAG	1 cut(s)	288
SmlI	CTYRAG	1 cut(s)	288
SmoI	CTYRAG	1 cut(s)	288
Sse9I	AATT	5 cut(s)	102, 266, 295, 321, 334
SsiI	CCGC	2 cut(s)	275, 397
SspMI	CTAG	1 cut(s)	251
TaaI	ACNGT	1 cut(s)	35
TaqI	TCGA	4 cut(s)	42, 289, 338, 426
TasI	AATT	5 cut(s)	102, 266, 295, 321, 334
TatI	WGTACW	1 cut(s)	60
TauI	GCSGC	1 cut(s)	278
TfiI	GAWTC	6 cut(s)	11, 47, 124, 161, 167, 361
Tru1I	TTAA	2 cut(s)	320, 401
Tru9I	TTAA	2 cut(s)	320, 401
TseI	GCWGC	2 cut(s)	6, 254
TspGWI	ACGGA	1 cut(s)	44
XapI	RAATTY	4 cut(s)	102, 266, 295, 334
XhoI	CTCGAG	1 cut(s)	288
XspI	CTAG	1 cut(s)	251

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.