RLG00000033203

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0014809
Physical Location & Seq
Reverse (-)
24436529 .. 24437480
952 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033203

Sequence Viewer

Length: 306 bp
ATGATCCACATACCAGAGAGACCGCCAGTGAAGCGACCAGATTCTAATCAGGTCCCTACCATGGAGCAACTGGAAGGAATCAGAAGTCGTTTGGGTGACCAAAGAGACAGAAATTCGGGTTATTCTCTCTCAGGTACTTCGGCAAGTAAAGCATTGGATTCCGATGTTGATTCCGATTATGATAATGTAGTGGTGGTTGGATTGGATTGTGAGAATGAAGGAGTATATGGATTAAAGGGTCCAAGACCCAGATACCCAAGAGCCTGGAAAGCAATAAGGAGATTGGGACATTTTGAAGTCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.32

Weight (kDa)

6.72

Isoelectric Point (pI)

42.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AcsI RAATTY 1 cut(s) 112
AfaI GTAC 1 cut(s) 136
AfiI CCNNNNNNNGG 1 cut(s) 61
AgsI TTSAA 1 cut(s) 296
AjnI CCWGG 1 cut(s) 263
Alw26I GTCTC 2 cut(s) 13, 99
ApoI RAATTY 1 cut(s) 112
AspS9I GGNCC 2 cut(s) 52, 239
AsuHPI GGTGA 1 cut(s) 107
AvaII GGWCC 2 cut(s) 52, 239
BciT130I CCWGG 1 cut(s) 265
BcoDI GTCTC 2 cut(s) 13, 99
Bme1390I CCNGG 1 cut(s) 265
Bme18I GGWCC 2 cut(s) 52, 239
BmgT120I GGNCC 2 cut(s) 52, 239
BmiI GGNNCC 2 cut(s) 54, 240
BmrFI CCNGG 1 cut(s) 265
BsaBI GATNNNNATC 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 61
Bse1I ACTGG 2 cut(s) 26, 75
Bse8I GATNNNNATC 1 cut(s) 45
BseBI CCWGG 1 cut(s) 265
BseDI CCNNGG 1 cut(s) 60
BseJI GATNNNNATC 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 2 cut(s) 26, 75
BslFI GGGAC 3 cut(s) 38, 284, 300
BslI CCNNNNNNNGG 1 cut(s) 61
BsmAI GTCTC 2 cut(s) 13, 99
BsmFI GGGAC 3 cut(s) 38, 284, 300
Bso31I GGTCTC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 1 cut(s) 60
BspACI CCGC 1 cut(s) 23
BspCNI CTCAG 1 cut(s) 143
BspLI GGNNCC 2 cut(s) 54, 240
BspTNI GGTCTC 1 cut(s) 13
BsrI ACTGG 2 cut(s) 26, 75
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 265
BstDEI CTNAG 1 cut(s) 130
BstDSI CCRYGG 1 cut(s) 60
BstEII GGTNACC 1 cut(s) 95
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 2 cut(s) 13, 99
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 3 cut(s) 31, 149, 269
BstNI CCWGG 1 cut(s) 265
BstPI GGTNACC 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 263
BstXI CCANNNNNNTGG 1 cut(s) 264
BtgI CCRYGG 1 cut(s) 60
BtsIMutI CAGTG 1 cut(s) 33
Cfr13I GGNCC 2 cut(s) 52, 239
Csp6I GTAC 1 cut(s) 135
CviAII CATG 1 cut(s) 61
CviJI RGCY 1 cut(s) 263
CviKI_1 RGCY 1 cut(s) 263
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 1 cut(s) 130
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 13
Eco47I GGWCC 2 cut(s) 52, 239
Eco91I GGTNACC 1 cut(s) 95
EcoO109I RGGNCCY 1 cut(s) 52
EcoO65I GGTNACC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 263
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 1 cut(s) 64
FaiI YATR 5 cut(s) 11, 62, 180, 226, 228
FaqI GGGAC 3 cut(s) 38, 284, 300
FatI CATG 1 cut(s) 60
Hin1II CATG 1 cut(s) 64
HinfI GANTC 4 cut(s) 41, 78, 158, 170
HphI GGTGA 1 cut(s) 107
Hpy188I TCNGA 3 cut(s) 83, 163, 175
HpyAV CCTTC 2 cut(s) 68, 212
HpyF10VI GCNNNNNNNGC 3 cut(s) 31, 149, 269
HpyF3I CTNAG 1 cut(s) 130
Hsp92II CATG 1 cut(s) 64
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 9 cut(s) 27, 35, 39, 51, 56, 117, 250, 262, 277
MaeIII GTNAC 1 cut(s) 95
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MluCI AATT 1 cut(s) 112
MmeI TCCRAC 1 cut(s) 178
MseI TTAA 2 cut(s) 233, 304
MspR9I CCNGG 1 cut(s) 265
MvaI CCWGG 1 cut(s) 265
MwoI GCNNNNNNNGC 3 cut(s) 31, 149, 269
NcoI CCATGG 1 cut(s) 60
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 2 cut(s) 54, 240
NmuCI GTSAC 1 cut(s) 95
PfeI GAWTC 4 cut(s) 41, 78, 158, 170
PpuMI RGGWCCY 1 cut(s) 52
Psp5II RGGWCCY 1 cut(s) 52
Psp6I CCWGG 1 cut(s) 263
PspEI GGTNACC 1 cut(s) 95
PspGI CCWGG 1 cut(s) 263
PspN4I GGNNCC 2 cut(s) 54, 240
PspPI GGNCC 2 cut(s) 52, 239
PspPPI RGGWCCY 1 cut(s) 52
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SaqAI TTAA 2 cut(s) 233, 304
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 2 cut(s) 52, 239
ScrFI CCNGG 1 cut(s) 265
SetI ASST 2 cut(s) 54, 136
SinI GGWCC 2 cut(s) 52, 239
Sse9I AATT 1 cut(s) 112
SsiI CCGC 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 263
StyI CCWWGG 1 cut(s) 60
TasI AATT 1 cut(s) 112
TfiI GAWTC 4 cut(s) 41, 78, 158, 170
Tru1I TTAA 2 cut(s) 233, 304
Tru9I TTAA 2 cut(s) 233, 304
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 231
TspRI CASTG 1 cut(s) 33
VpaK11BI GGWCC 2 cut(s) 52, 239
XapI RAATTY 1 cut(s) 112
XcmI CCANNNNNNNNNTGG 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.