RchiOBHm_Chr4g0423441

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
49064546 .. 49065647
1102 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39280

Sequence Viewer

Length: 153 bp
ATGTTCTTAAATGATCCTCATGGCATTTCTGATCAGGGTATTGACAACAACATCTTATTGGAGACTATCAAGAAGATGCAATGTGAAAGAGAATATCTTATTCAGTCTCTAATTCAGGGGGAACACACAGAGGTGGATTTTGGACATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.8

Weight (kDa)

4.58

Isoelectric Point (pI)

22.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 8
AleI CACNNNNGTG 1 cut(s) 131
Alw26I GTCTC 2 cut(s) 56, 111
AlwI GGATC 1 cut(s) 8
BclI TGATCA 1 cut(s) 31
BcoDI GTCTC 2 cut(s) 56, 111
BmsI GCATC 1 cut(s) 66
Bse3DI GCAATG 1 cut(s) 86
BseMI GCAATG 1 cut(s) 86
BsmAI GTCTC 2 cut(s) 56, 111
Bsp143I GATC 2 cut(s) 13, 31
BspPI GGATC 1 cut(s) 8
BsrDI GCAATG 1 cut(s) 86
BssMI GATC 2 cut(s) 13, 31
BstKTI GATC 2 cut(s) 16, 34
BstMAI GTCTC 2 cut(s) 56, 111
BstMBI GATC 2 cut(s) 13, 31
CviAII CATG 1 cut(s) 20
DpnI GATC 2 cut(s) 15, 33
DpnII GATC 2 cut(s) 13, 31
FaeI CATG 1 cut(s) 23
FaiI YATR 1 cut(s) 21
FatI CATG 1 cut(s) 19
FbaI TGATCA 1 cut(s) 31
Hin1II CATG 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 79
Hsp92II CATG 1 cut(s) 23
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 2 cut(s) 13, 31
LpnPI CCDG 2 cut(s) 20, 101
LweI GCATC 1 cut(s) 66
MalI GATC 2 cut(s) 15, 33
MboI GATC 2 cut(s) 13, 31
MboII GAAGA 1 cut(s) 85
MluCI AATT 1 cut(s) 111
MnlI CCTC 2 cut(s) 27, 124
MseI TTAA 1 cut(s) 8
MslI CAYNNNNRTG 1 cut(s) 131
NdeII GATC 2 cut(s) 13, 31
NlaIII CATG 1 cut(s) 23
OliI CACNNNNGTG 1 cut(s) 131
RseI CAYNNNNRTG 1 cut(s) 131
SaqAI TTAA 1 cut(s) 8
Sau3AI GATC 2 cut(s) 13, 31
SetI ASST 1 cut(s) 135
SfaNI GCATC 1 cut(s) 66
SgeI CNNG 4 cut(s) 32, 47, 82, 128
SmiMI CAYNNNNRTG 1 cut(s) 131
Sse9I AATT 1 cut(s) 111
TasI AATT 1 cut(s) 111
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.