Rroxscaffold_2G00090430

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
12162702 .. 12166484
3783 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00090430.1

Sequence Viewer

Length: 327 bp
ATGCTGGGGGTTCCGTTGCCAAGTGAAAGAAAGGCATACATATTTCAACGACAGACCGTGGCAATCAAAATATTATCTTTTAAAGGATTTGCAAAAGTTAATCATGTGACACTACGTAAATTTAAGAAGAGAGGTATTGACAACAACATCCTATTGGAGACTATCAAGAAGACGCAATGTGAGAGGGAATATCTTATTCGGTCTCTAATTCGGGGGAACACACAGAGGTGGGTTTTGGCATTTGGTGCCACCAAGAAGACCCTTCAAGAAGAGACAGTAAGACCCACAACAAAGAATGTAATGTCAATGCTTCAAGCAGCAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.45

Weight (kDa)

10.69

Isoelectric Point (pI)

42.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 245
AcsI RAATTY 1 cut(s) 119
AgsI TTSAA 3 cut(s) 47, 266, 314
AleI CACNNNNGTG 1 cut(s) 226
Alw26I GTCTC 3 cut(s) 152, 207, 266
ApeKI GCWGC 1 cut(s) 317
ApoI RAATTY 1 cut(s) 119
BanI GGYRCC 1 cut(s) 245
BbsI GAAGAC 2 cut(s) 176, 263
BcoDI GTCTC 3 cut(s) 152, 207, 266
BisI GCNGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 319
BmiI GGNNCC 2 cut(s) 12, 247
BpiI GAAGAC 2 cut(s) 176, 263
BsaAI YACGTR 1 cut(s) 116
BsaI GGTCTC 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 57
Bse3DI GCAATG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 147
BseMI GCAATG 1 cut(s) 182
BseYI CCCAGC 1 cut(s) 4
BshNI GGYRCC 1 cut(s) 245
BsmAI GTCTC 3 cut(s) 152, 207, 266
Bso31I GGTCTC 1 cut(s) 207
BspLI GGNNCC 2 cut(s) 12, 247
BspT107I GGYRCC 1 cut(s) 245
BspTNI GGTCTC 1 cut(s) 207
BsrDI GCAATG 1 cut(s) 182
BssECI CCNNGG 1 cut(s) 57
Bst4CI ACNGT 2 cut(s) 58, 277
Bst6I CTCTTC 2 cut(s) 122, 264
BstAPI GCANNNNNTGC 1 cut(s) 245
BstBAI YACGTR 1 cut(s) 116
BstDSI CCRYGG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 147
BstMAI GTCTC 3 cut(s) 152, 207, 266
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstSNI TACGTA 1 cut(s) 116
BstV2I GAAGAC 2 cut(s) 176, 263
BtgI CCRYGG 1 cut(s) 57
BtsCI GGATG 1 cut(s) 147
CseI GACGC 1 cut(s) 181
CviAII CATG 1 cut(s) 104
DraI TTTAAA 1 cut(s) 82
Eam1104I CTCTTC 2 cut(s) 122, 264
EarI CTCTTC 2 cut(s) 122, 264
Eco105I TACGTA 1 cut(s) 116
Eco31I GGTCTC 1 cut(s) 207
FaeI CATG 1 cut(s) 107
FaiI YATR 3 cut(s) 37, 41, 105
FatI CATG 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 318
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 318
GluI GCNGC 1 cut(s) 318
GsaI CCCAGC 1 cut(s) 8
HgaI GACGC 1 cut(s) 181
Hin1II CATG 1 cut(s) 107
Hpy188III TCNNGA 2 cut(s) 166, 266
HpyAV CCTTC 1 cut(s) 272
HpyCH4III ACNGT 2 cut(s) 58, 277
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 1 cut(s) 107
MaeII ACGT 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 106
MboII GAAGA 4 cut(s) 139, 181, 268, 281
MluCI AATT 2 cut(s) 119, 207
MnlI CCTC 3 cut(s) 125, 177, 219
MseI TTAA 4 cut(s) 81, 99, 123, 325
MslI CAYNNNNRTG 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 245
NlaIII CATG 1 cut(s) 107
NlaIV GGNNCC 2 cut(s) 12, 247
NmuCI GTSAC 1 cut(s) 106
OliI CACNNNNGTG 1 cut(s) 226
PkrI GCNGC 1 cut(s) 319
Ppu21I YACGTR 1 cut(s) 116
PspFI CCCAGC 1 cut(s) 4
PspN4I GGNNCC 2 cut(s) 12, 247
RseI CAYNNNNRTG 1 cut(s) 226
SaqAI TTAA 4 cut(s) 81, 99, 123, 325
SatI GCNGC 1 cut(s) 318
SetI ASST 3 cut(s) 118, 136, 230
SgeI CNNG 8 cut(s) 17, 33, 70, 116, 178, 224, 265, 278
SmiMI CAYNNNNRTG 1 cut(s) 226
SnaBI TACGTA 1 cut(s) 116
Sse9I AATT 2 cut(s) 119, 207
SspI AATATT 1 cut(s) 72
TaaI ACNGT 2 cut(s) 58, 277
TaiI ACGT 1 cut(s) 118
TaqII GACCGA 1 cut(s) 189
TasI AATT 2 cut(s) 119, 207
Tru1I TTAA 4 cut(s) 81, 99, 123, 325
Tru9I TTAA 4 cut(s) 81, 99, 123, 325
TseFI GTSAC 1 cut(s) 106
TseI GCWGC 1 cut(s) 317
Tsp45I GTSAC 1 cut(s) 106
XapI RAATTY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.