Rh2AG543900

protein serine/threonine kinase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
77239334 .. 77241032
1699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG543900.1

Sequence Viewer

Length: 249 bp
ATGACGGAATGGGATCCAAAGCAGCGTATCACCATCCGAGAAATCAAGAACCATAGATGGTTTCAAGGTGGGGATCAAATGTTCTTAAATGATCCTCATGGCATTTCTGATCAGGGTATTGACAACAACATCCTATTGGAGACTATCAAGAAGACGCAATGTGAAAGAGAATATCTTATTCAGTCTCTAATTCAGGGGGAACACACAGAGGAAACCACCACATACAAACTGTTGAAGAAGAAGATGTAA

Protein Analysis

82

Amino Acids

9.8

Weight (kDa)

6.27

Isoelectric Point (pI)

35.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 8, 21, 81, 86
AgsI TTSAA 2 cut(s) 65, 235
AloI GAACNNNNNNTCC 2 cut(s) 65, 97
Alw26I GTCTC 2 cut(s) 134, 189
AlwI GGATC 4 cut(s) 8, 21, 81, 86
ApeKI GCWGC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 22
BamHI GGATCC 1 cut(s) 13
BbsI GAAGAC 1 cut(s) 158
BbvI GCAGC 1 cut(s) 34
BccI CCATC 2 cut(s) 41, 51
BclI TGATCA 1 cut(s) 109
BcoDI GTCTC 2 cut(s) 134, 189
BisI GCNGC 1 cut(s) 23
BlsI GCNGC 1 cut(s) 24
BmiI GGNNCC 1 cut(s) 15
BpiI GAAGAC 1 cut(s) 158
Bse3DI GCAATG 1 cut(s) 164
BseGI GGATG 2 cut(s) 33, 129
BseMI GCAATG 1 cut(s) 164
BseXI GCAGC 1 cut(s) 34
BsmAI GTCTC 2 cut(s) 134, 189
Bsp143I GATC 4 cut(s) 13, 73, 91, 109
BspLI GGNNCC 1 cut(s) 15
BspPI GGATC 4 cut(s) 8, 21, 81, 86
BsrDI GCAATG 1 cut(s) 164
BssMI GATC 4 cut(s) 13, 73, 91, 109
Bst4CI ACNGT 1 cut(s) 231
BstF5I GGATG 2 cut(s) 33, 129
BstKTI GATC 4 cut(s) 16, 76, 94, 112
BstMAI GTCTC 2 cut(s) 134, 189
BstMBI GATC 4 cut(s) 13, 73, 91, 109
BstV1I GCAGC 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtsCI GGATG 2 cut(s) 33, 129
CseI GACGC 1 cut(s) 163
CviAII CATG 1 cut(s) 98
DpnI GATC 4 cut(s) 15, 75, 93, 111
DpnII GATC 4 cut(s) 13, 73, 91, 109
FaeI CATG 1 cut(s) 101
FaiI YATR 3 cut(s) 54, 99, 223
FatI CATG 1 cut(s) 97
FbaI TGATCA 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 23
FokI GGATG 2 cut(s) 20, 116
Fsp4HI GCNGC 1 cut(s) 23
GluI GCNGC 1 cut(s) 23
HgaI GACGC 1 cut(s) 163
Hin1II CATG 1 cut(s) 101
HphI GGTGA 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 38, 109
Hpy188III TCNNGA 2 cut(s) 46, 148
HpyCH4III ACNGT 1 cut(s) 231
Hsp92II CATG 1 cut(s) 101
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 4 cut(s) 13, 73, 91, 109
LpnPI CCDG 2 cut(s) 98, 179
Lsp1109I GCAGC 1 cut(s) 34
MalI GATC 4 cut(s) 15, 75, 93, 111
MboI GATC 4 cut(s) 13, 73, 91, 109
MboII GAAGA 2 cut(s) 163, 247
MflI RGATCY 1 cut(s) 13
MluCI AATT 1 cut(s) 189
MnlI CCTC 2 cut(s) 105, 202
MseI TTAA 1 cut(s) 86
NdeII GATC 4 cut(s) 13, 73, 91, 109
NlaIII CATG 1 cut(s) 101
NlaIV GGNNCC 1 cut(s) 15
PkrI GCNGC 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 15
PsuI RGATCY 1 cut(s) 13
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 1 cut(s) 23
Sau3AI GATC 4 cut(s) 13, 73, 91, 109
SetI ASST 1 cut(s) 70
SgeI CNNG 7 cut(s) 50, 58, 77, 110, 125, 160, 206
Sse9I AATT 1 cut(s) 189
TaaI ACNGT 1 cut(s) 231
TasI AATT 1 cut(s) 189
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TseI GCWGC 1 cut(s) 22
TspGWI ACGGA 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.