Rw2G044940

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Forward (+)
71786598 .. 71789874
3277 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G044940.1

Sequence Viewer

Length: 255 bp
ATGACAGCATGGGAACCAAAGGATCGTATCAACATCCGAGAAATCAAGAACCACCGATGGTTTCAAGGTGGGGATCAAATGTTCTTAAATGATCCTCATGGCATTTCTGATCAGGGTATTGACAACAATATCCTATTGGAGGCTATCAAGAAGACGCAATGTGAGAGGGAATATCTTATTCAGTCTCTAATTCAGGGGGAACACACAGGAAACCACCACATACAAGCTGTTGAAGAAGAAGATGCAAAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.8

Weight (kDa)

5.21

Isoelectric Point (pI)

43.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 30, 81, 86
AfiI CCNNNNNNNGG 1 cut(s) 139
AgsI TTSAA 2 cut(s) 65, 233
AloI GAACNNNNNNTCC 2 cut(s) 65, 97
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
Alw26I GTCTC 1 cut(s) 189
AlwI GGATC 3 cut(s) 30, 81, 86
BbsI GAAGAC 1 cut(s) 158
BccI CCATC 1 cut(s) 51
BclI TGATCA 1 cut(s) 109
BcoDI GTCTC 1 cut(s) 189
BmiI GGNNCC 1 cut(s) 15
BmsI GCATC 1 cut(s) 232
BpiI GAAGAC 1 cut(s) 158
Bsc4I CCNNNNNNNGG 1 cut(s) 139
Bse3DI GCAATG 1 cut(s) 164
BseGI GGATG 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMI GCAATG 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 189
Bsp143I GATC 4 cut(s) 22, 73, 91, 109
BspLI GGNNCC 1 cut(s) 15
BspPI GGATC 3 cut(s) 30, 81, 86
BsrDI GCAATG 1 cut(s) 164
BssMI GATC 4 cut(s) 22, 73, 91, 109
BstENI CCTNNNNNAGG 1 cut(s) 137
BstF5I GGATG 1 cut(s) 33
BstKTI GATC 4 cut(s) 25, 76, 94, 112
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 4 cut(s) 22, 73, 91, 109
BstV2I GAAGAC 1 cut(s) 158
BtsCI GGATG 1 cut(s) 33
CseI GACGC 1 cut(s) 163
CviAII CATG 2 cut(s) 9, 98
CviJI RGCY 2 cut(s) 143, 227
CviKI_1 RGCY 2 cut(s) 143, 227
DpnI GATC 4 cut(s) 24, 75, 93, 111
DpnII GATC 4 cut(s) 22, 73, 91, 109
EcoNI CCTNNNNNAGG 1 cut(s) 137
FaeI CATG 2 cut(s) 12, 101
FaiI YATR 3 cut(s) 10, 99, 221
FatI CATG 2 cut(s) 8, 97
FbaI TGATCA 1 cut(s) 109
FokI GGATG 1 cut(s) 20
HgaI GACGC 1 cut(s) 163
Hin1II CATG 2 cut(s) 12, 101
Hpy188I TCNGA 2 cut(s) 38, 109
Hpy188III TCNNGA 2 cut(s) 46, 148
HpyCH4V TGCA 1 cut(s) 245
Hsp92II CATG 2 cut(s) 12, 101
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 4 cut(s) 22, 73, 91, 109
LpnPI CCDG 3 cut(s) 98, 179, 192
LweI GCATC 1 cut(s) 232
MalI GATC 4 cut(s) 24, 75, 93, 111
MboI GATC 4 cut(s) 22, 73, 91, 109
MboII GAAGA 4 cut(s) 163, 245, 248, 251
MluCI AATT 1 cut(s) 189
MnlI CCTC 3 cut(s) 105, 133, 159
MseI TTAA 1 cut(s) 86
NdeII GATC 4 cut(s) 22, 73, 91, 109
NlaIII CATG 2 cut(s) 12, 101
NlaIV GGNNCC 1 cut(s) 15
PspN4I GGNNCC 1 cut(s) 15
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 4 cut(s) 22, 73, 91, 109
SetI ASST 2 cut(s) 70, 229
SfaNI GCATC 1 cut(s) 232
Sse9I AATT 1 cut(s) 189
TasI AATT 1 cut(s) 189
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XagI CCTNNNNNAGG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.