RchiOBHm_Chr4g0441361

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0007436
Physical Location & Seq
Forward (+)
63214605 .. 63216005
1401 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40921

Sequence Viewer

Length: 393 bp
ATGAGGCTCTACAATGGCTTCCTTGACATTCTGAAGATTCAGAAGTTTCGGAGAATCGTGTCATATACTGGGTTCTACTGCTTCACAGTGGTCTTGAGCTACGCTTACACAAGCAACACCTCACGTTGTTCTGGGTTTTCCAGAACTAGAGCTGGGTTTTCCAGAGGTGACCAATTCTATGCGTCGTACCCAGCCGGAACTGAGCTTCTGACAGACCAAGCTAAGTTGTATAAAGCTGCCCTTGGTAATTGTTTTGAAACCCAAGAATGGGGTCCTATTGAGTACTGCATCATGGCTAAACACTTTGAGCGTCAGGGGAAAGGGCCTTATGCGTGCCATGCTCAATACATGGCACATCTTCTATCTCTTGGGCAACTTGATGGAAGTGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.72

Weight (kDa)

8.99

Isoelectric Point (pI)

36.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 53
AfaI GTAC 2 cut(s) 188, 284
AfiI CCNNNNNNNGG 2 cut(s) 267, 268
AgsI TTSAA 1 cut(s) 257
AluBI AGCT 5 cut(s) 99, 152, 205, 221, 236
AluI AGCT 5 cut(s) 99, 152, 205, 221, 236
AoxI GGCC 1 cut(s) 323
ApeKI GCWGC 1 cut(s) 236
AspS9I GGNCC 2 cut(s) 272, 323
AsuHPI GGTGA 1 cut(s) 179
AvaII GGWCC 1 cut(s) 272
BbvI GCAGC 1 cut(s) 223
BccI CCATC 1 cut(s) 374
BfaI CTAG 2 cut(s) 147, 391
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
BmcAI AGTACT 1 cut(s) 284
Bme18I GGWCC 1 cut(s) 272
BmgT120I GGNCC 2 cut(s) 272, 323
BmiI GGNNCC 1 cut(s) 273
BmrI ACTGGG 1 cut(s) 78
BmsI GCATC 1 cut(s) 297
BmuI ACTGGG 1 cut(s) 78
BpuEI CTTGAG 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 241
Bsc4I CCNNNNNNNGG 2 cut(s) 267, 268
Bse1I ACTGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 241
BseLI CCNNNNNNNGG 2 cut(s) 267, 268
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 1 cut(s) 73
BseXI GCAGC 1 cut(s) 223
BseYI CCCAGC 2 cut(s) 152, 190
BshFI GGCC 1 cut(s) 325
BsiSI CCGG 1 cut(s) 195
BslI CCNNNNNNNGG 2 cut(s) 267, 268
BsnI GGCC 1 cut(s) 325
BspANI GGCC 1 cut(s) 325
BspCNI CTCAG 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 273
BsrI ACTGG 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 241
BssT1I CCWWGG 1 cut(s) 241
Bst4CI ACNGT 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 334
BstDEI CTNAG 2 cut(s) 201, 222
BstEII GGTNACC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 338
BstPI GGTNACC 1 cut(s) 167
BstV1I GCAGC 1 cut(s) 223
BsuRI GGCC 1 cut(s) 325
BtsIMutI CAGTG 1 cut(s) 93
Cac8I GCNNGC 1 cut(s) 334
Cfr13I GGNCC 2 cut(s) 272, 323
CseI GACGC 2 cut(s) 171, 299
Csp6I GTAC 2 cut(s) 187, 283
CviAII CATG 3 cut(s) 292, 338, 349
CviQI GTAC 2 cut(s) 187, 283
DdeI CTNAG 2 cut(s) 201, 222
Eco130I CCWWGG 1 cut(s) 241
Eco47I GGWCC 1 cut(s) 272
Eco57I CTGAAG 1 cut(s) 53
Eco91I GGTNACC 1 cut(s) 167
EcoO109I RGGNCCY 2 cut(s) 272, 323
EcoO65I GGTNACC 1 cut(s) 167
EcoT14I CCWWGG 1 cut(s) 241
ErhI CCWWGG 1 cut(s) 241
FaeI CATG 3 cut(s) 295, 341, 352
FaiI YATR 8 cut(s) 64, 66, 180, 231, 293, 330, 339, 350
FalI AAGNNNNNCTT 2 cut(s) 225, 257
FatI CATG 3 cut(s) 291, 337, 348
Fnu4HI GCNGC 1 cut(s) 237
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 2 cut(s) 147, 391
GluI GCNGC 1 cut(s) 237
GsaI CCCAGC 2 cut(s) 156, 194
HaeIII GGCC 1 cut(s) 325
HapII CCGG 1 cut(s) 195
HgaI GACGC 2 cut(s) 171, 299
Hin1II CATG 3 cut(s) 295, 341, 352
HinfI GANTC 2 cut(s) 37, 54
HpaII CCGG 1 cut(s) 195
HphI GGTGA 1 cut(s) 179
Hpy188I TCNGA 4 cut(s) 33, 42, 51, 210
Hpy188III TCNNGA 3 cut(s) 94, 141, 162
Hpy99I CGWCG 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 288
HpyF10VI GCNNNNNNNGC 1 cut(s) 338
HpyF3I CTNAG 2 cut(s) 201, 222
HpySE526I ACGT 1 cut(s) 124
Hsp92II CATG 3 cut(s) 295, 341, 352
LpnPI CCDG 8 cut(s) 54, 117, 138, 154, 175, 204, 208, 299
Lsp1109I GCAGC 1 cut(s) 223
LweI GCATC 1 cut(s) 297
MaeI CTAG 2 cut(s) 147, 391
MaeII ACGT 1 cut(s) 124
MaeIII GTNAC 1 cut(s) 167
MboII GAAGA 2 cut(s) 46, 350
MluCI AATT 2 cut(s) 173, 247
MnlI CCTC 2 cut(s) 130, 158
MspI CCGG 1 cut(s) 195
MwoI GCNNNNNNNGC 1 cut(s) 338
NlaIII CATG 3 cut(s) 295, 341, 352
NlaIV GGNNCC 1 cut(s) 273
NmuCI GTSAC 1 cut(s) 167
PfeI GAWTC 2 cut(s) 37, 54
PkrI GCNGC 1 cut(s) 238
PpuMI RGGWCCY 1 cut(s) 272
Psp5II RGGWCCY 1 cut(s) 272
PspEI GGTNACC 1 cut(s) 167
PspFI CCCAGC 2 cut(s) 152, 190
PspN4I GGNNCC 1 cut(s) 273
PspPI GGNCC 2 cut(s) 272, 323
PspPPI RGGWCCY 1 cut(s) 272
RsaI GTAC 2 cut(s) 188, 284
RsaNI GTAC 2 cut(s) 187, 283
SatI GCNGC 1 cut(s) 237
Sau96I GGNCC 2 cut(s) 272, 323
ScaI AGTACT 1 cut(s) 284
SetI ASST 8 cut(s) 101, 122, 127, 154, 169, 207, 223, 238
SfaNI GCATC 1 cut(s) 297
SinI GGWCC 1 cut(s) 272
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 2 cut(s) 173, 247
SspMI CTAG 2 cut(s) 147, 391
StyI CCWWGG 1 cut(s) 241
TaaI ACNGT 1 cut(s) 88
TaiI ACGT 1 cut(s) 127
TasI AATT 2 cut(s) 173, 247
TatI WGTACW 1 cut(s) 282
TfiI GAWTC 2 cut(s) 37, 54
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 167
TseI GCWGC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 167
TspRI CASTG 1 cut(s) 93
VpaK11BI GGWCC 1 cut(s) 272
XspI CTAG 2 cut(s) 147, 391
ZrmI AGTACT 1 cut(s) 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.