RLG00000006098

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0007436
Physical Location & Seq
Reverse (-)
4348069 .. 4349460
1392 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000006098

Sequence Viewer

Length: 369 bp
ATGAGGCTCTACAATGGCTTCCTTGAAATTCTGAAGATTCAGAAGTTTCGGAGAATCGTGTCATATACTGGGTTCTACTGCTTCACAGCGGTCTTGAGCTACGCTTACACAAGCAACACAACTAGAGCTGGGTTTTCCAGAGGTGACCAATTCTATGCGTCGTACCCATCTGGAACTGAGCTCCTGACGGACCAAGCTAAGTTGTATAAAGCTGCCCTTGGTAATTGTTTTGAAACCGAAGAATGGGGTCCGATTGAGTACTGCATCATGGCTAAACACTTTGAGCGTCAGGGGAAAGGGCCTTATGCGTACCATGCTCAATACATGGCCCATCTTCTATCTCTTGGGCAACTTGGTGGAAGTGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.85

Weight (kDa)

8.75

Isoelectric Point (pI)

35.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AcsI RAATTY 1 cut(s) 27
AcuI CTGAAG 1 cut(s) 53
AfaI GTAC 3 cut(s) 164, 260, 311
AfiI CCNNNNNNNGG 1 cut(s) 243
AgsI TTSAA 2 cut(s) 26, 233
AluBI AGCT 5 cut(s) 99, 128, 181, 197, 212
AluI AGCT 5 cut(s) 99, 128, 181, 197, 212
Alw21I GWGCWC 1 cut(s) 183
AoxI GGCC 2 cut(s) 299, 327
ApeKI GCWGC 1 cut(s) 212
ApoI RAATTY 1 cut(s) 27
AspS9I GGNCC 4 cut(s) 190, 248, 299, 328
AsuHPI GGTGA 1 cut(s) 155
AvaII GGWCC 2 cut(s) 190, 248
BanII GRGCYC 1 cut(s) 183
Bbv12I GWGCWC 1 cut(s) 183
BbvI GCAGC 1 cut(s) 199
BccI CCATC 2 cut(s) 175, 339
BfaI CTAG 2 cut(s) 123, 367
BisI GCNGC 1 cut(s) 213
BlsI GCNGC 1 cut(s) 214
BmcAI AGTACT 1 cut(s) 260
Bme18I GGWCC 2 cut(s) 190, 248
BmgT120I GGNCC 4 cut(s) 190, 248, 299, 328
BmiI GGNNCC 1 cut(s) 249
BmrI ACTGGG 1 cut(s) 78
BmsI GCATC 1 cut(s) 273
BmuI ACTGGG 1 cut(s) 78
BpuEI CTTGAG 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 217
Bsc4I CCNNNNNNNGG 1 cut(s) 243
Bse1I ACTGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 217
BseLI CCNNNNNNNGG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 168
BseNI ACTGG 1 cut(s) 73
BseXI GCAGC 1 cut(s) 199
BseYI CCCAGC 1 cut(s) 128
BshFI GGCC 2 cut(s) 301, 329
BsiHKAI GWGCWC 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 243
BsnI GGCC 2 cut(s) 301, 329
Bsp1286I GDGCHC 1 cut(s) 183
BspACI CCGC 1 cut(s) 89
BspANI GGCC 2 cut(s) 301, 329
BspCNI CTCAG 1 cut(s) 169
BspLI GGNNCC 1 cut(s) 249
BsrI ACTGG 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 217
BssT1I CCWWGG 1 cut(s) 217
BstDEI CTNAG 2 cut(s) 177, 198
BstEII GGTNACC 1 cut(s) 143
BstMWI GCNNNNNNNGC 1 cut(s) 314
BstPI GGTNACC 1 cut(s) 143
BstV1I GCAGC 1 cut(s) 199
BsuRI GGCC 2 cut(s) 301, 329
Cfr13I GGNCC 4 cut(s) 190, 248, 299, 328
CseI GACGC 2 cut(s) 147, 275
Csp6I GTAC 3 cut(s) 163, 259, 310
CviAII CATG 3 cut(s) 268, 314, 325
CviQI GTAC 3 cut(s) 163, 259, 310
DdeI CTNAG 2 cut(s) 177, 198
Ecl136II GAGCTC 1 cut(s) 181
Eco130I CCWWGG 1 cut(s) 217
Eco24I GRGCYC 1 cut(s) 183
Eco47I GGWCC 2 cut(s) 190, 248
Eco53kI GAGCTC 1 cut(s) 181
Eco57I CTGAAG 1 cut(s) 53
Eco91I GGTNACC 1 cut(s) 143
EcoICRI GAGCTC 1 cut(s) 181
EcoO109I RGGNCCY 1 cut(s) 299
EcoO65I GGTNACC 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 217
EcoT38I GRGCYC 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 217
FaeI CATG 3 cut(s) 271, 317, 328
FaiI YATR 8 cut(s) 64, 66, 156, 207, 269, 306, 315, 326
FalI AAGNNNNNCTT 2 cut(s) 201, 233
FatI CATG 3 cut(s) 267, 313, 324
Fnu4HI GCNGC 1 cut(s) 213
FriOI GRGCYC 1 cut(s) 183
Fsp4HI GCNGC 1 cut(s) 213
FspBI CTAG 2 cut(s) 123, 367
GluI GCNGC 1 cut(s) 213
GsaI CCCAGC 1 cut(s) 132
HaeIII GGCC 2 cut(s) 301, 329
HgaI GACGC 2 cut(s) 147, 275
Hin1II CATG 3 cut(s) 271, 317, 328
HinfI GANTC 2 cut(s) 37, 54
HphI GGTGA 1 cut(s) 155
Hpy188I TCNGA 4 cut(s) 33, 42, 51, 252
Hpy188III TCNNGA 4 cut(s) 94, 138, 171, 184
Hpy99I CGWCG 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 264
HpyF10VI GCNNNNNNNGC 1 cut(s) 314
HpyF3I CTNAG 2 cut(s) 177, 198
Hsp92II CATG 3 cut(s) 271, 317, 328
LmnI GCTCC 1 cut(s) 186
LpnPI CCDG 6 cut(s) 54, 114, 151, 156, 197, 275
Lsp1109I GCAGC 1 cut(s) 199
LweI GCATC 1 cut(s) 273
MaeI CTAG 2 cut(s) 123, 367
MaeIII GTNAC 1 cut(s) 143
MboII GAAGA 3 cut(s) 46, 251, 326
MhlI GDGCHC 1 cut(s) 183
MluCI AATT 3 cut(s) 27, 149, 223
MnlI CCTC 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 89
MwoI GCNNNNNNNGC 1 cut(s) 314
NlaIII CATG 3 cut(s) 271, 317, 328
NlaIV GGNNCC 1 cut(s) 249
NmuCI GTSAC 1 cut(s) 143
PfeI GAWTC 2 cut(s) 37, 54
PkrI GCNGC 1 cut(s) 214
Psp124BI GAGCTC 1 cut(s) 183
PspEI GGTNACC 1 cut(s) 143
PspFI CCCAGC 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 249
PspPI GGNCC 4 cut(s) 190, 248, 299, 328
RsaI GTAC 3 cut(s) 164, 260, 311
RsaNI GTAC 3 cut(s) 163, 259, 310
SacI GAGCTC 1 cut(s) 183
SatI GCNGC 1 cut(s) 213
Sau96I GGNCC 4 cut(s) 190, 248, 299, 328
ScaI AGTACT 1 cut(s) 260
SduI GDGCHC 1 cut(s) 183
SetI ASST 6 cut(s) 101, 130, 145, 183, 199, 214
SfaNI GCATC 1 cut(s) 273
SinI GGWCC 2 cut(s) 190, 248
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 3 cut(s) 27, 149, 223
SsiI CCGC 1 cut(s) 89
SspMI CTAG 2 cut(s) 123, 367
SstI GAGCTC 1 cut(s) 183
StyI CCWWGG 1 cut(s) 217
TasI AATT 3 cut(s) 27, 149, 223
TatI WGTACW 1 cut(s) 258
TfiI GAWTC 2 cut(s) 37, 54
TseFI GTSAC 1 cut(s) 143
TseI GCWGC 1 cut(s) 212
Tsp45I GTSAC 1 cut(s) 143
TspGWI ACGGA 1 cut(s) 203
VpaK11BI GGWCC 2 cut(s) 190, 248
XapI RAATTY 1 cut(s) 27
XspI CTAG 2 cut(s) 123, 367
ZrmI AGTACT 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.