RchiOBHm_Chr5g0002031

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
1146781 .. 1150578
3798 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28341

Sequence Viewer

Length: 252 bp
ATGCAGAGAGGGAAACTGTATGTTGGATATTATGCGGCTATGAAGGGGTTCTCTGCTTTGCTTATCGGCATTGATATCAGGAACAGTGAGCTGTCAAAATCTCCAAGTATTTCAAATTTAGTGATGGCATCGAAAACTGTAGCAAGAGAAACAAAGAGAATGCTAGGACAGTGTGATGGCATTCAGAATTCTGCTTCAACGAGAATTGATAGCTCAAGAAGATCAAAGATGTGGAAAACAGTTGAGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.28

Weight (kDa)

10.34

Isoelectric Point (pI)

46.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AcsI RAATTY 2 cut(s) 115, 187
AgsI TTSAA 2 cut(s) 114, 198
AluBI AGCT 2 cut(s) 91, 213
AluI AGCT 2 cut(s) 91, 213
ApoI RAATTY 2 cut(s) 115, 187
Asp700I GAANNNNTTC 1 cut(s) 47
BccI CCATC 2 cut(s) 118, 170
BfaI CTAG 1 cut(s) 164
BfmI CTRYAG 1 cut(s) 138
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
BmsI GCATC 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 199
BsmI GAATGC 2 cut(s) 165, 180
Bsp143I GATC 1 cut(s) 221
BspACI CCGC 1 cut(s) 35
BssMI GATC 1 cut(s) 221
Bst4CI ACNGT 5 cut(s) 18, 86, 139, 171, 241
BstKTI GATC 1 cut(s) 224
BstMBI GATC 1 cut(s) 221
BstSFI CTRYAG 1 cut(s) 138
BtsIMutI CAGTG 2 cut(s) 91, 176
CviJI RGCY 3 cut(s) 38, 91, 213
CviKI_1 RGCY 3 cut(s) 38, 91, 213
DpnI GATC 1 cut(s) 223
DpnII GATC 1 cut(s) 221
Eco32I GATATC 1 cut(s) 76
EcoRI GAATTC 1 cut(s) 187
EcoRV GATATC 1 cut(s) 76
FaiI YATR 3 cut(s) 21, 33, 41
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 1 cut(s) 164
GluI GCNGC 1 cut(s) 36
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 2 cut(s) 79, 216
HpyAV CCTTC 1 cut(s) 37
HpyCH4III ACNGT 5 cut(s) 18, 86, 139, 171, 241
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 1 cut(s) 221
LpnPI CCDG 1 cut(s) 64
LweI GCATC 1 cut(s) 137
MaeI CTAG 1 cut(s) 164
MalI GATC 1 cut(s) 223
MboI GATC 1 cut(s) 221
MboII GAAGA 1 cut(s) 231
MluCI AATT 3 cut(s) 115, 187, 204
MmeI TCCRAC 1 cut(s) 4
MnlI CCTC 1 cut(s) 240
MroXI GAANNNNTTC 1 cut(s) 47
Mva1269I GAATGC 2 cut(s) 165, 180
NdeII GATC 1 cut(s) 221
PctI GAATGC 2 cut(s) 165, 180
PdmI GAANNNNTTC 1 cut(s) 47
PkrI GCNGC 1 cut(s) 37
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 1 cut(s) 221
SetI ASST 3 cut(s) 93, 215, 251
SfaNI GCATC 1 cut(s) 137
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 6 cut(s) 91, 117, 156, 176, 213, 228
SmlI CTYRAG 1 cut(s) 214
SmoI CTYRAG 1 cut(s) 214
Sse9I AATT 3 cut(s) 115, 187, 204
SsiI CCGC 1 cut(s) 35
SspMI CTAG 1 cut(s) 164
TaaI ACNGT 5 cut(s) 18, 86, 139, 171, 241
TaqI TCGA 1 cut(s) 131
TasI AATT 3 cut(s) 115, 187, 204
TauI GCSGC 1 cut(s) 38
TscAI CASTG 2 cut(s) 91, 176
TspDTI ATGAA 1 cut(s) 56
TspRI CASTG 2 cut(s) 91, 176
XapI RAATTY 2 cut(s) 115, 187
XmnI GAANNNNTTC 1 cut(s) 47
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.