Rh3AG286500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
33943977 .. 33950964
6988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG286500.1

Sequence Viewer

Length: 213 bp
ATGAAGACCACTGGTGTAGAGGAACAAGTTGAAGATTATGCGTTTTGGGGTGAATTCAGAAAGATATTCAAGGGAGGATTGGCAAAGAAGAAGCGGTTCTTTGCTTTGCTTAGCTCACTGGCATTGATGCAGAGAGGGAAACTCTATGTTGGATATTATGTGGCTATGAAGGGGTTCTCTGCTTTGCTTATCAGCATTGAGACGAAGGAGCTG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.13

Weight (kDa)

9.65

Isoelectric Point (pI)

22.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 94
AcsI RAATTY 1 cut(s) 53
AgsI TTSAA 2 cut(s) 32, 70
AluBI AGCT 2 cut(s) 114, 211
AluI AGCT 2 cut(s) 114, 211
Alw26I GTCTC 1 cut(s) 194
ApoI RAATTY 1 cut(s) 53
Asp700I GAANNNNTTC 2 cut(s) 95, 173
AsuHPI GGTGA 1 cut(s) 62
BbsI GAAGAC 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 194
BlpI GCTNAGC 1 cut(s) 110
BmsI GCATC 1 cut(s) 117
BpiI GAAGAC 1 cut(s) 11
BplI GAGNNNNNCTC 2 cut(s) 126, 158
Bpu1102I GCTNAGC 1 cut(s) 110
Bse1I ACTGG 2 cut(s) 16, 123
BseNI ACTGG 2 cut(s) 16, 123
BsmAI GTCTC 1 cut(s) 194
BsmBI CGTCTC 1 cut(s) 194
Bsp1720I GCTNAGC 1 cut(s) 110
BspACI CCGC 1 cut(s) 94
BsrI ACTGG 2 cut(s) 16, 123
BstDEI CTNAG 1 cut(s) 110
BstMAI GTCTC 1 cut(s) 194
BstV2I GAAGAC 1 cut(s) 11
BtsIMutI CAGTG 2 cut(s) 9, 116
CviJI RGCY 3 cut(s) 114, 164, 211
CviKI_1 RGCY 3 cut(s) 114, 164, 211
DdeI CTNAG 1 cut(s) 110
EcoRI GAATTC 1 cut(s) 53
Esp3I CGTCTC 1 cut(s) 194
FaiI YATR 4 cut(s) 39, 147, 159, 167
FalI AAGNNNNNCTT 2 cut(s) 83, 115
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 59
HpyAV CCTTC 2 cut(s) 163, 199
HpyCH4V TGCA 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 110
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 1 cut(s) 104
LweI GCATC 1 cut(s) 117
MboII GAAGA 3 cut(s) 16, 44, 100
MluCI AATT 1 cut(s) 53
MmeI TCCRAC 1 cut(s) 130
MnlI CCTC 3 cut(s) 13, 68, 128
MroXI GAANNNNTTC 2 cut(s) 95, 173
PdmI GAANNNNTTC 2 cut(s) 95, 173
SetI ASST 2 cut(s) 116, 213
SfaNI GCATC 1 cut(s) 117
SgeI CNNG 4 cut(s) 24, 38, 82, 131
Sse9I AATT 1 cut(s) 53
SsiI CCGC 1 cut(s) 94
TasI AATT 1 cut(s) 53
TscAI CASTG 2 cut(s) 16, 123
TspDTI ATGAA 2 cut(s) 17, 182
TspRI CASTG 2 cut(s) 16, 123
XapI RAATTY 1 cut(s) 53
XmnI GAANNNNTTC 2 cut(s) 95, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.