Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0008111

Physical Location & Seq

Genomic Coordinates Forward (+)

32947124 .. 32952488

Gene Structure 5365 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00026190.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGCAGAGAGGGAAACTCTTTGTTGGATATTATGTGGCTATGAAGGGGTTCTCTGCTTTGCTTATCGGCATTGGTAACTCATCTATCGTAGTCTTCTTATTCCTCTTACTTGGGTCTTTTGAATTAATTCTAGGAAGTGAGGGTTACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000902 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005802 GO:0008150 GO:0009653 GO:0009826 GO:0009987 GO:0012505 GO:0016020 GO:0016043 GO:0016049 GO:0031984 GO:0032502 GO:0032989 GO:0040007 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0048589 GO:0048856 GO:0048869 GO:0060560 GO:0071840 GO:0098791

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CBS Voltage_CLC

Protein Analysis

49

Amino Acids

5.32

Weight (kDa)

8.14

Isoelectric Point (pI)

5.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008111)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g28410 FvH4_4g00590
rosa_chinensis	RchiOBHm_Chr2g0134111 RchiOBHm_Chr5g0002031 RchiOBHm_Chr7g0215551 RchiOBHm_Chr7g0228431
rosa_laevigata	RLG00000019702 RLG00000022667 RLG00000034803
rosa_multiflora	Rmu_sc0039029.1_g000001
rosa_roxburghii	Rroxscaffold_1G00026190 Rroxscaffold_1G00035480 Rroxscaffold_3G00255880 Rroxscaffold_3G00259100 Rroxscaffold_5G00358790 Rroxscaffold_6G00410130
rosa_rugosa	Rorug05G0224200
rosa_samantha	Rh2AG558900 Rh3AG286500 Rh5AG156600 Rh5AG305700 Rh5DG047000 Rh5DG343000
rosa_wichuraiana	Rw5G031880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	122
AseI	ATTAAT	1 cut(s)	125
Asp700I	GAANNNNTTC	2 cut(s)	47, 126
BbsI	GAAGAC	1 cut(s)	85
BfaI	CTAG	1 cut(s)	131
BpiI	GAAGAC	1 cut(s)	85
BplI	GAGNNNNNCTC	1 cut(s)	32
BstV2I	GAAGAC	1 cut(s)	85
CviJI	RGCY	1 cut(s)	38
CviKI_1	RGCY	1 cut(s)	38
FaiI	YATR	2 cut(s)	33, 41
FspBI	CTAG	1 cut(s)	131
HpyAV	CCTTC	1 cut(s)	37
HpyCH4V	TGCA	1 cut(s)	4
MaeI	CTAG	1 cut(s)	131
MaeIII	GTNAC	2 cut(s)	74, 143
MboII	GAAGA	1 cut(s)	85
MluCI	AATT	2 cut(s)	122, 126
MmeI	TCCRAC	1 cut(s)	4
MnlI	CCTC	2 cut(s)	113, 133
MroXI	GAANNNNTTC	2 cut(s)	47, 126
MseI	TTAA	1 cut(s)	125
PdmI	GAANNNNTTC	2 cut(s)	47, 126
PshBI	ATTAAT	1 cut(s)	125
SaqAI	TTAA	1 cut(s)	125
SgeI	CNNG	2 cut(s)	122, 143
Sse9I	AATT	2 cut(s)	122, 126
SspMI	CTAG	1 cut(s)	131
TasI	AATT	2 cut(s)	122, 126
Tru1I	TTAA	1 cut(s)	125
Tru9I	TTAA	1 cut(s)	125
TspDTI	ATGAA	1 cut(s)	56
VspI	ATTAAT	1 cut(s)	125
XmnI	GAANNNNTTC	2 cut(s)	47, 126
XspI	CTAG	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.