Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0017762

Physical Location & Seq

Genomic Coordinates Forward (+)

29671706 .. 29671970

Gene Structure 265 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ31448

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGTATGATCGTCACTCTGCTATTCATATTGCTGCCGCTAATGGTCAGATCGAGATTCTTTCTCTGCTGTTGGAACGATCTGTAAATCCTGATGCGTTGAATCGTCACAAGCAGGTGATGTTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004842 GO:0006464 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0009605 GO:0009607 GO:0009617 GO:0009987 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0032446 GO:0036211 GO:0042742 GO:0043170 GO:0043207 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0050896 GO:0051704 GO:0051707 GO:0051865 GO:0070647 GO:0071704 GO:0098542 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Ank_3 Ank_4 Ank_5

Protein Analysis

41

Amino Acids

4.67

Weight (kDa)

6.81

Isoelectric Point (pI)

76.91

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ank	PF00023	5 - 34	2.3e-06	Ankyrin repeat

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017762)

Species	Orthologous Gene IDs
pyrus_communis	pycom15g30290
rosa_chinensis	RchiOBHm_Chr1g0313891 RchiOBHm_Chr5g0035641
rosa_laevigata	RLG00000028647 RLG00000028655
rosa_multiflora	Rmu_sc0001493.1_g000070 Rmu_sc0019734.1_g000002
rosa_samantha	Rh3AG278700 Rh4DG183500 Rh4DG183800 Rh5CG517100 Rh5DG450200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	103
Acc36I	ACCTGC	1 cut(s)	103
AciI	CCGC	1 cut(s)	36
AgsI	TTSAA	1 cut(s)	100
ApeKI	GCWGC	1 cut(s)	32
BbvI	GCAGC	1 cut(s)	19
BfuAI	ACCTGC	1 cut(s)	103
BisI	GCNGC	2 cut(s)	33, 36
BlsI	GCNGC	2 cut(s)	34, 37
BmsI	GCATC	1 cut(s)	82
BseXI	GCAGC	1 cut(s)	19
Bsp143I	GATC	3 cut(s)	7, 48, 77
BspACI	CCGC	1 cut(s)	36
BspMI	ACCTGC	1 cut(s)	103
BssMI	GATC	3 cut(s)	7, 48, 77
BstKTI	GATC	3 cut(s)	10, 51, 80
BstMBI	GATC	3 cut(s)	7, 48, 77
BstV1I	GCAGC	1 cut(s)	19
BveI	ACCTGC	1 cut(s)	103
DpnI	GATC	3 cut(s)	9, 50, 79
DpnII	GATC	3 cut(s)	7, 48, 77
FaiI	YATR	2 cut(s)	6, 27
Fnu4HI	GCNGC	2 cut(s)	33, 36
Fsp4HI	GCNGC	2 cut(s)	33, 36
FspEI	CC	5 cut(s)	27, 49, 56, 98, 102
GluI	GCNGC	2 cut(s)	33, 36
HinfI	GANTC	2 cut(s)	55, 100
Hpy188I	TCNGA	1 cut(s)	48
Hpy188III	TCNNGA	2 cut(s)	52, 89
Kzo9I	GATC	3 cut(s)	7, 48, 77
LpnPI	CCDG	2 cut(s)	98, 102
Lsp1109I	GCAGC	1 cut(s)	19
LweI	GCATC	1 cut(s)	82
MaeIII	GTNAC	2 cut(s)	11, 104
MalI	GATC	3 cut(s)	9, 50, 79
MboI	GATC	3 cut(s)	7, 48, 77
MmeI	TCCRAC	1 cut(s)	51
NdeII	GATC	3 cut(s)	7, 48, 77
NmuCI	GTSAC	2 cut(s)	11, 104
PaqCI	CACCTGC	1 cut(s)	103
PfeI	GAWTC	2 cut(s)	55, 100
PkrI	GCNGC	2 cut(s)	34, 37
SatI	GCNGC	2 cut(s)	33, 36
Sau3AI	GATC	3 cut(s)	7, 48, 77
SetI	ASST	1 cut(s)	117
SfaNI	GCATC	1 cut(s)	82
SgeI	CNNG	3 cut(s)	64, 101, 121
SsiI	CCGC	1 cut(s)	36
TaqI	TCGA	1 cut(s)	51
TauI	GCSGC	1 cut(s)	38
TfiI	GAWTC	2 cut(s)	55, 100
TseFI	GTSAC	2 cut(s)	11, 104
TseI	GCWGC	1 cut(s)	32
Tsp45I	GTSAC	2 cut(s)	11, 104
TspDTI	ATGAA	1 cut(s)	14

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.