RchiOBHm_Chr5g0075441

Plant protein of unknown function (DUF868)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0017083
Physical Location & Seq
Forward (+)
81251644 .. 81252012
369 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35016

Sequence Viewer

Length: 369 bp
ATGTTGGAAGTTGGGAGAGAAGATCATGACATTGTCATTGAAGCTTCACTATCAGGGCCTAATGATCCTGAAATGTGGATTACTGTAGACGGGACAATGACGATTCGGATCGTGAACTTGAATTGGAGATTTAGAGGGAATGAGAGTGTGATGTTGAATGATTTTCCAGTTGAAATTTTGTGGGATGTGTATGATTGGTTGTTTAGTAAACAAGCCACAGGCCAAGGCTTGTTCATTTTCAAGCCAGGCAGGCTTGATTGGGAGTCTAGTCATAGTGACCCTGGTAGTAGAAATTCTGAATACAACTCACCAAAAGAGAGCTCATCAACTATAGAGTTTATGCCTGGAAAACTGAGTAAGAGTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF868

Protein Analysis

122

Amino Acids

13.92

Weight (kDa)

4.61

Isoelectric Point (pI)

45.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF868 PF05910 6 - 100 6.5e-33 Plant protein of unknown function (DUF868)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017083)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G13229
fragaria_vesca FvH4_3g42170
malus_domestica MD03G1037200.v1.1 MD11G1038300.v1.1
pyrus_communis pycom03g02860
rosa_chinensis RchiOBHm_Chr5g0075431 RchiOBHm_Chr5g0075441
rosa_laevigata RLG00000036561
rosa_multiflora Rmu_sc0000770.1_g000016
rosa_rugosa Rorug05G0439500
rosa_samantha Rh5BG517800 Rh5CG541400
rosa_wichuraiana Rw5G046040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 87
AclWI GGATC 2 cut(s) 59, 116
AcsI RAATTY 2 cut(s) 174, 292
AgsI TTSAA 5 cut(s) 41, 121, 157, 173, 241
AjnI CCWGG 3 cut(s) 244, 280, 343
AluBI AGCT 2 cut(s) 44, 321
AluI AGCT 2 cut(s) 44, 321
Alw21I GWGCWC 1 cut(s) 323
AlwI GGATC 2 cut(s) 59, 116
AoxI GGCC 2 cut(s) 56, 220
ApoI RAATTY 2 cut(s) 174, 292
AspS9I GGNCC 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 300
BanII GRGCYC 1 cut(s) 323
Bbv12I GWGCWC 1 cut(s) 323
BciT130I CCWGG 3 cut(s) 246, 282, 345
BfaI CTAG 1 cut(s) 267
BfmI CTRYAG 2 cut(s) 84, 330
BglI GCCNNNNNGGC 1 cut(s) 250
Bme1390I CCNGG 3 cut(s) 246, 282, 345
BmgT120I GGNCC 1 cut(s) 56
BmrFI CCNGG 3 cut(s) 246, 282, 345
BsaBI GATNNNNATC 1 cut(s) 107
BsaJI CCNNGG 2 cut(s) 223, 280
Bse1I ACTGG 1 cut(s) 167
Bse8I GATNNNNATC 1 cut(s) 107
BseBI CCWGG 3 cut(s) 246, 282, 345
BseDI CCNNGG 2 cut(s) 223, 280
BseGI GGATG 1 cut(s) 190
BseJI GATNNNNATC 1 cut(s) 107
BseMII CTCAG 1 cut(s) 344
BseNI ACTGG 1 cut(s) 167
BshFI GGCC 2 cut(s) 58, 222
BsiHKAI GWGCWC 1 cut(s) 323
BslFI GGGAC 1 cut(s) 106
BsmFI GGGAC 1 cut(s) 106
BsnI GGCC 2 cut(s) 58, 222
Bsp1286I GDGCHC 1 cut(s) 323
Bsp143I GATC 3 cut(s) 22, 64, 108
BspANI GGCC 2 cut(s) 58, 222
BspCNI CTCAG 1 cut(s) 345
BspHI TCATGA 1 cut(s) 25
BspPI GGATC 2 cut(s) 59, 116
BsrI ACTGG 1 cut(s) 167
BssECI CCNNGG 2 cut(s) 223, 280
BssMI GATC 3 cut(s) 22, 64, 108
BssT1I CCWWGG 1 cut(s) 223
Bst2UI CCWGG 3 cut(s) 246, 282, 345
Bst4CI ACNGT 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 251
BstDEI CTNAG 1 cut(s) 353
BstF5I GGATG 1 cut(s) 190
BstKTI GATC 3 cut(s) 25, 67, 111
BstMBI GATC 3 cut(s) 22, 64, 108
BstMWI GCNNNNNNNGC 1 cut(s) 250
BstNI CCWGG 3 cut(s) 246, 282, 345
BstSCI CCNGG 3 cut(s) 244, 280, 343
BstSFI CTRYAG 2 cut(s) 84, 330
BsuRI GGCC 2 cut(s) 58, 222
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 1 cut(s) 251
CciI TCATGA 1 cut(s) 25
Cfr13I GGNCC 1 cut(s) 56
CviAII CATG 1 cut(s) 26
CviJI RGCY 8 cut(s) 44, 58, 215, 222, 228, 244, 253, 321
CviKI_1 RGCY 8 cut(s) 44, 58, 215, 222, 228, 244, 253, 321
DdeI CTNAG 1 cut(s) 353
DpnI GATC 3 cut(s) 24, 66, 110
DpnII GATC 3 cut(s) 22, 64, 108
Ecl136II GAGCTC 1 cut(s) 321
Eco130I CCWWGG 1 cut(s) 223
Eco24I GRGCYC 1 cut(s) 323
Eco53kI GAGCTC 1 cut(s) 321
EcoICRI GAGCTC 1 cut(s) 321
EcoO109I RGGNCCY 1 cut(s) 56
EcoRII CCWGG 3 cut(s) 244, 280, 343
EcoT14I CCWWGG 1 cut(s) 223
EcoT38I GRGCYC 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 1 cut(s) 29
FaiI YATR 5 cut(s) 27, 192, 273, 332, 341
FaqI GGGAC 1 cut(s) 106
FatI CATG 1 cut(s) 25
FblI GTMKAC 1 cut(s) 87
FokI GGATG 1 cut(s) 197
FriOI GRGCYC 1 cut(s) 323
FspBI CTAG 1 cut(s) 267
HaeIII GGCC 2 cut(s) 58, 222
Hin1II CATG 1 cut(s) 29
HindIII AAGCTT 1 cut(s) 42
HinfI GANTC 2 cut(s) 103, 263
HphI GGTGA 1 cut(s) 300
Hpy166II GTNNAC 3 cut(s) 88, 115, 209
Hpy188I TCNGA 2 cut(s) 108, 298
Hpy188III TCNNGA 3 cut(s) 26, 68, 112
Hpy8I GTNNAC 3 cut(s) 88, 115, 209
HpyCH4III ACNGT 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 1 cut(s) 250
HpyF3I CTNAG 1 cut(s) 353
Hsp92II CATG 1 cut(s) 29
Kzo9I GATC 3 cut(s) 22, 64, 108
MaeI CTAG 1 cut(s) 267
MaeIII GTNAC 1 cut(s) 275
MalI GATC 3 cut(s) 24, 66, 110
MboI GATC 3 cut(s) 22, 64, 108
MboII GAAGA 1 cut(s) 32
MhlI GDGCHC 1 cut(s) 323
MluCI AATT 3 cut(s) 121, 174, 292
MlyI GAGTC 1 cut(s) 272
MnlI CCTC 1 cut(s) 128
MspR9I CCNGG 3 cut(s) 246, 282, 345
MvaI CCWGG 3 cut(s) 246, 282, 345
MwoI GCNNNNNNNGC 1 cut(s) 250
NdeII GATC 3 cut(s) 22, 64, 108
NlaIII CATG 1 cut(s) 29
NmuCI GTSAC 1 cut(s) 275
PagI TCATGA 1 cut(s) 25
PfeI GAWTC 1 cut(s) 103
PflFI GACNNNGTC 1 cut(s) 32
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
Psp124BI GAGCTC 1 cut(s) 323
Psp6I CCWGG 3 cut(s) 244, 280, 343
PspGI CCWGG 3 cut(s) 244, 280, 343
PspPI GGNCC 1 cut(s) 56
PsyI GACNNNGTC 1 cut(s) 32
SacI GAGCTC 1 cut(s) 323
Sau3AI GATC 3 cut(s) 22, 64, 108
Sau96I GGNCC 1 cut(s) 56
SchI GAGTC 1 cut(s) 272
ScrFI CCNGG 3 cut(s) 246, 282, 345
SduI GDGCHC 1 cut(s) 323
SetI ASST 2 cut(s) 46, 323
SfcI CTRYAG 2 cut(s) 84, 330
Sse9I AATT 3 cut(s) 121, 174, 292
SspMI CTAG 1 cut(s) 267
SstI GAGCTC 1 cut(s) 323
StyD4I CCNGG 3 cut(s) 244, 280, 343
StyI CCWWGG 1 cut(s) 223
TaaI ACNGT 1 cut(s) 85
TasI AATT 3 cut(s) 121, 174, 292
TfiI GAWTC 1 cut(s) 103
TseFI GTSAC 1 cut(s) 275
Tsp45I GTSAC 1 cut(s) 275
TspDTI ATGAA 1 cut(s) 223
Tth111I GACNNNGTC 1 cut(s) 32
XapI RAATTY 2 cut(s) 174, 292
XmiI GTMKAC 1 cut(s) 87
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.