RchiOBHm_Chr6g0280731

RWP-RK domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0016931
Physical Location & Seq
Forward (+)
44144568 .. 44144717
150 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25175

Sequence Viewer

Length: 150 bp
ATGTTTGGCCTGCATGCTTCTGTGGCAATTCCCTTTCGAAGTGTCTATACTGGATCAGCTGATTTTGTTCTAGAGTTTTTCTTACCCAAGGATTGCCCAGATCCTGAAAAACAGAAGCAGATGCTCAACTCATTCTGCATTGTTACATAA

Protein Analysis

49

Amino Acids

5.53

Weight (kDa)

5.5

Isoelectric Point (pI)

29.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GAF_NLP PF22922 1 - 46 1.9e-17 NLP protein GAF domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 61, 95
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AlwI GGATC 2 cut(s) 61, 95
AlwNI CAGNNNCTG 1 cut(s) 104
AoxI GGCC 1 cut(s) 7
AsuII TTCGAA 1 cut(s) 37
BarI GAAGNNNNNNTAC 2 cut(s) 31, 63
BfaI CTAG 1 cut(s) 71
BmsI GCATC 1 cut(s) 111
Bpu14I TTCGAA 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 87
Bse1I ACTGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 55
BshFI GGCC 1 cut(s) 9
BsnI GGCC 1 cut(s) 9
Bsp119I TTCGAA 1 cut(s) 37
Bsp143I GATC 2 cut(s) 53, 100
BspANI GGCC 1 cut(s) 9
BspPI GGATC 2 cut(s) 61, 95
BspT104I TTCGAA 1 cut(s) 37
BsrI ACTGG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 87
BssMI GATC 2 cut(s) 53, 100
BssT1I CCWWGG 1 cut(s) 87
BstBI TTCGAA 1 cut(s) 37
BstC8I GCNNGC 2 cut(s) 11, 15
BstKTI GATC 2 cut(s) 56, 103
BstMBI GATC 2 cut(s) 53, 100
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 17
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 9
Cac8I GCNNGC 2 cut(s) 11, 15
CaiI CAGNNNCTG 1 cut(s) 104
CviAII CATG 1 cut(s) 14
CviJI RGCY 2 cut(s) 9, 59
CviKI_1 RGCY 2 cut(s) 9, 59
DpnI GATC 2 cut(s) 55, 102
DpnII GATC 2 cut(s) 53, 100
Eco130I CCWWGG 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 87
ErhI CCWWGG 1 cut(s) 87
FaeI CATG 1 cut(s) 17
FaiI YATR 3 cut(s) 15, 48, 148
FatI CATG 1 cut(s) 13
FspBI CTAG 1 cut(s) 71
HaeIII GGCC 1 cut(s) 9
Hin1II CATG 1 cut(s) 17
Hpy188III TCNNGA 2 cut(s) 71, 104
HpyCH4V TGCA 2 cut(s) 13, 138
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 2 cut(s) 53, 100
LpnPI CCDG 4 cut(s) 23, 36, 111, 117
LweI GCATC 1 cut(s) 111
MaeI CTAG 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 142
MalI GATC 2 cut(s) 55, 102
MboI GATC 2 cut(s) 53, 100
MflI RGATCY 1 cut(s) 100
MluCI AATT 1 cut(s) 27
MspA1I CMGCKG 1 cut(s) 59
MwoI GCNNNNNNNGC 1 cut(s) 23
NdeII GATC 2 cut(s) 53, 100
NlaIII CATG 1 cut(s) 17
NspI RCATGY 1 cut(s) 17
NspV TTCGAA 1 cut(s) 37
PaeI GCATGC 1 cut(s) 17
PstNI CAGNNNCTG 1 cut(s) 104
PsuI RGATCY 1 cut(s) 100
PvuII CAGCTG 1 cut(s) 59
Sau3AI GATC 2 cut(s) 53, 100
SetI ASST 1 cut(s) 61
SfaNI GCATC 1 cut(s) 111
SfuI TTCGAA 1 cut(s) 37
SgeI CNNG 7 cut(s) 22, 26, 63, 83, 100, 110, 116
SphI GCATGC 1 cut(s) 17
Sse9I AATT 1 cut(s) 27
SspMI CTAG 1 cut(s) 71
StyI CCWWGG 1 cut(s) 87
TaqI TCGA 1 cut(s) 37
TasI AATT 1 cut(s) 27
XbaI TCTAGA 1 cut(s) 70
XceI RCATGY 1 cut(s) 17
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.