RchiOBHm_Chr6g0281301

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
44618337 .. 44618700
364 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25230

Sequence Viewer

Length: 165 bp
ATGAAGAATCAGTTTGCTGATGCATTGGCCACACTAGTTTCCATGATCAGTAGACGGTATTGGTATCCGAGTCGACGAATCGGATTGAAATCAGTTACAAGGGTTGGGTTGAAGAGAAATAGGAAAGGTTCGGTTTATCAAGTTTATGTGGTAGATCTGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.31

Weight (kDa)

11.03

Isoelectric Point (pI)

29.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 52, 73
AcoI YGGCCR 1 cut(s) 27
AgsI TTSAA 2 cut(s) 88, 112
AhlI ACTAGT 1 cut(s) 34
AoxI GGCC 1 cut(s) 27
BalI TGGCCA 1 cut(s) 29
BciVI GTATCC 1 cut(s) 75
BclI TGATCA 1 cut(s) 45
BcuI ACTAGT 1 cut(s) 34
BfaI CTAG 1 cut(s) 35
BfuI GTATCC 1 cut(s) 75
BglII AGATCT 1 cut(s) 154
BmsI GCATC 1 cut(s) 10
BsaBI GATNNNNATC 1 cut(s) 88
Bse8I GATNNNNATC 1 cut(s) 88
BseJI GATNNNNATC 1 cut(s) 88
BshFI GGCC 1 cut(s) 29
BsnI GGCC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 45, 154
BspANI GGCC 1 cut(s) 29
BssMI GATC 2 cut(s) 45, 154
Bst4CI ACNGT 1 cut(s) 57
Bst6I CTCTTC 1 cut(s) 107
BstKTI GATC 2 cut(s) 48, 157
BstMBI GATC 2 cut(s) 45, 154
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BsuI GTATCC 1 cut(s) 75
BsuRI GGCC 1 cut(s) 29
CviAII CATG 1 cut(s) 43
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DpnI GATC 2 cut(s) 47, 156
DpnII GATC 2 cut(s) 45, 154
EaeI YGGCCR 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
EcoT22I ATGCAT 1 cut(s) 25
FaeI CATG 1 cut(s) 46
FaiI YATR 3 cut(s) 44, 147, 163
FatI CATG 1 cut(s) 42
FbaI TGATCA 1 cut(s) 45
FblI GTMKAC 2 cut(s) 52, 73
FspBI CTAG 1 cut(s) 35
HaeIII GGCC 1 cut(s) 29
Hin1II CATG 1 cut(s) 46
HincII GTYRAC 1 cut(s) 74
HindII GTYRAC 1 cut(s) 74
HinfI GANTC 3 cut(s) 7, 70, 78
Hpy166II GTNNAC 2 cut(s) 53, 74
Hpy188I TCNGA 3 cut(s) 69, 83, 159
Hpy8I GTNNAC 2 cut(s) 53, 74
Hpy99I CGWCG 1 cut(s) 78
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 23
Hsp92II CATG 1 cut(s) 46
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 2 cut(s) 45, 154
LweI GCATC 1 cut(s) 10
MaeI CTAG 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 94
MalI GATC 2 cut(s) 47, 156
MboI GATC 2 cut(s) 45, 154
MboII GAAGA 2 cut(s) 16, 124
MflI RGATCY 1 cut(s) 154
MlsI TGGCCA 1 cut(s) 29
MluNI TGGCCA 1 cut(s) 29
MlyI GAGTC 1 cut(s) 79
Mox20I TGGCCA 1 cut(s) 29
Mph1103I ATGCAT 1 cut(s) 25
MscI TGGCCA 1 cut(s) 29
Msp20I TGGCCA 1 cut(s) 29
NdeII GATC 2 cut(s) 45, 154
NlaIII CATG 1 cut(s) 46
NsiI ATGCAT 1 cut(s) 25
PfeI GAWTC 2 cut(s) 7, 78
PleI GAGTC 1 cut(s) 78
PpsI GAGTC 1 cut(s) 78
PsuI RGATCY 1 cut(s) 154
SalI GTCGAC 1 cut(s) 72
Sau3AI GATC 2 cut(s) 45, 154
SchI GAGTC 1 cut(s) 79
SetI ASST 1 cut(s) 130
SfaNI GCATC 1 cut(s) 10
SgeI CNNG 5 cut(s) 47, 55, 81, 111, 152
SpeI ACTAGT 1 cut(s) 34
SspMI CTAG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 57
TaqI TCGA 1 cut(s) 73
TfiI GAWTC 2 cut(s) 7, 78
TspDTI ATGAA 1 cut(s) 17
XmiI GTMKAC 2 cut(s) 52, 73
XspI CTAG 1 cut(s) 35
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.