RchiOBHm_Chr7g0186961

Spindle and kinetochore-associated protein 2

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
6695083 .. 6695355
273 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16688

Sequence Viewer

Length: 273 bp
ATGGGACAAGAGCATCATGAAGCAACAGAGGGGTTGGTGAGGCTGTTGATGAAAGCGAACCACGATCTGACAGTGGTTCAGCACAATCTCGACAGGGAGTTGCAACAAAGCTATCCCCAAAATGCAAACCTGATGAAGCTGGTTTCCAGAATTAAGAAAATTCAGCAAGACTTGTCCACTTTGGAAGATCAGTGTCGTCAAGTTCTAACCGCCAAGCAGGATTTGATTGACAAGGCTAGGACCACTCTCGTCGGGAACAGAAATCTAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.38

Weight (kDa)

7.95

Isoelectric Point (pI)

38.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SKA2 PF16740 6 - 90 1.2e-30 Spindle and kinetochore-associated protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 210
AcsI RAATTY 1 cut(s) 159
AluBI AGCT 2 cut(s) 111, 139
AluI AGCT 2 cut(s) 111, 139
ApoI RAATTY 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 240
AsuHPI GGTGA 1 cut(s) 49
AvaII GGWCC 1 cut(s) 240
BfaI CTAG 1 cut(s) 237
Bme18I GGWCC 1 cut(s) 240
BmgT120I GGNCC 1 cut(s) 240
BmsI GCATC 1 cut(s) 22
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
Bsp143I GATC 2 cut(s) 64, 187
BspACI CCGC 1 cut(s) 210
BspHI TCATGA 1 cut(s) 16
BssMI GATC 2 cut(s) 64, 187
Bst4CI ACNGT 1 cut(s) 73
BstKTI GATC 2 cut(s) 67, 190
BstMBI GATC 2 cut(s) 64, 187
BtsIMutI CAGTG 2 cut(s) 78, 197
CciI TCATGA 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 240
CviAII CATG 1 cut(s) 17
CviJI RGCY 4 cut(s) 43, 111, 139, 236
CviKI_1 RGCY 4 cut(s) 43, 111, 139, 236
DpnI GATC 2 cut(s) 66, 189
DpnII GATC 2 cut(s) 64, 187
Eco47I GGWCC 1 cut(s) 240
FaeI CATG 1 cut(s) 20
FaiI YATR 1 cut(s) 18
FaqI GGGAC 1 cut(s) 18
FatI CATG 1 cut(s) 16
FspBI CTAG 1 cut(s) 237
Hin1II CATG 1 cut(s) 20
HphI GGTGA 1 cut(s) 49
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 69
Hpy188III TCNNGA 4 cut(s) 17, 89, 147, 253
Hpy8I GTNNAC 1 cut(s) 177
Hpy99I CGWCG 1 cut(s) 254
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 103, 125
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 2 cut(s) 64, 187
LpnPI CCDG 5 cut(s) 79, 125, 143, 160, 203
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 237
MalI GATC 2 cut(s) 66, 189
MboI GATC 2 cut(s) 64, 187
MboII GAAGA 1 cut(s) 197
MluCI AATT 2 cut(s) 150, 159
MnlI CCTC 2 cut(s) 22, 33
MseI TTAA 1 cut(s) 153
NdeII GATC 2 cut(s) 64, 187
NlaIII CATG 1 cut(s) 20
PagI TCATGA 1 cut(s) 16
PspPI GGNCC 1 cut(s) 240
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 2 cut(s) 64, 187
Sau96I GGNCC 1 cut(s) 240
SetI ASST 3 cut(s) 113, 132, 141
SfaNI GCATC 1 cut(s) 22
SinI GGWCC 1 cut(s) 240
Sse9I AATT 2 cut(s) 150, 159
SsiI CCGC 1 cut(s) 210
SspMI CTAG 1 cut(s) 237
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 90
TasI AATT 2 cut(s) 150, 159
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TscAI CASTG 2 cut(s) 78, 197
TspDTI ATGAA 3 cut(s) 33, 65, 149
TspRI CASTG 2 cut(s) 78, 197
VpaK11BI GGWCC 1 cut(s) 240
XapI RAATTY 1 cut(s) 159
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.