Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001434.1

Orthogroup ID

OG0006708

Physical Location & Seq

Genomic Coordinates Reverse (-)

67084 .. 68634

Gene Structure 1551 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001434.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

atggggcaagagcatcatgaagcgacggaggggttggtgaggctgctgacgaaagcgaaccacgatctgacagtggttcaacacaggctcgacaaggagtttcaacaaatctatccccaaaatgcaaacccgatgaagctggtttctagaattaagaaaattcagcaagacttgtccactttggaagaccagtgccgtcaacttctaacagccaagcaggatttgattgacaaggctaggaccactctcgtcgggaacagaaatctagtgcagcggatggaggcatccatgggcatttcccccaatactgattctgatgattctgctttcgccaacttcaatcagatcatcgatgagtggaaggtccaagctagatcaaaagcaggtgatgaaatagatacagatgtgcatgatatcaatacgttactattttcaaccatagtttcaagcaactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SKA2

Protein Analysis

151

Amino Acids

17.12

Weight (kDa)

5.47

Isoelectric Point (pI)

24.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006708)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G24970
fragaria_vesca	FvH4_2g41341 FvH4_2g41341 FvH4_2g41341
malus_domestica	MD08G1052100.v1.1 MD15G1043400.v1.1
prunus_persica	Prupe.1G396800_v2.0.a1 Prupe.1G396800_v2.0.a1 Prupe.1G396800_v2.0.a1
pyrus_communis	pycom08g04350 pycom15g04030
rosa_chinensis	RchiOBHm_Chr6g0299191 RchiOBHm_Chr7g0186961
rosa_laevigata	RLG00000011455
rosa_multiflora	Rmu_co8351649.1_g000001 Rmu_sc0001434.1_g000013
rosa_roxburghii	Rroxscaffold_7G00168930
rosa_rugosa	Rorug06G0286100
rosa_samantha	Rh6AG397000 Rh6BG405700 Rh6CG411800 Rh6DG398500 Rh7AG083800 Rh7CG084800 Rh7DG085700
rosa_wichuraiana	Rw6G034770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	374
Acc36I	ACCTGC	1 cut(s)	374
AciI	CCGC	1 cut(s)	274
AcsI	RAATTY	1 cut(s)	159
AgsI	TTSAA	5 cut(s)	80, 104, 340, 435, 447
AluBI	AGCT	2 cut(s)	139, 371
AluI	AGCT	2 cut(s)	139, 371
ApeKI	GCWGC	2 cut(s)	43, 271
ApoI	RAATTY	1 cut(s)	159
AspS9I	GGNCC	2 cut(s)	240, 364
AsuHPI	GGTGA	2 cut(s)	49, 398
AvaII	GGWCC	2 cut(s)	240, 364
BaeI	ACNNNNGTAYC	2 cut(s)	390, 423
BbsI	GAAGAC	1 cut(s)	192
BbvI	GCAGC	2 cut(s)	30, 283
BccI	CCATC	1 cut(s)	271
BceAI	ACGGC	1 cut(s)	180
BfaI	CTAG	4 cut(s)	147, 237, 266, 372
BfuAI	ACCTGC	1 cut(s)	374
BisI	GCNGC	2 cut(s)	44, 272
BlsI	GCNGC	2 cut(s)	45, 273
Bme18I	GGWCC	2 cut(s)	240, 364
BmgT120I	GGNCC	2 cut(s)	240, 364
BmsI	GCATC	2 cut(s)	22, 293
BpiI	GAAGAC	1 cut(s)	192
Bsa29I	ATCGAT	1 cut(s)	351
BsaJI	CCNNGG	1 cut(s)	288
Bse1I	ACTGG	1 cut(s)	190
BseCI	ATCGAT	1 cut(s)	351
BseDI	CCNNGG	1 cut(s)	288
BseGI	GGATG	2 cut(s)	282, 284
BseNI	ACTGG	1 cut(s)	190
BseXI	GCAGC	2 cut(s)	30, 283
BsgI	GTGCAG	1 cut(s)	290
BshVI	ATCGAT	1 cut(s)	351
Bsp143I	GATC	3 cut(s)	64, 345, 374
Bsp19I	CCATGG	1 cut(s)	288
BspACI	CCGC	1 cut(s)	274
BspDI	ATCGAT	1 cut(s)	351
BspHI	TCATGA	1 cut(s)	16
BspMI	ACCTGC	1 cut(s)	374
BsrI	ACTGG	1 cut(s)	190
BssECI	CCNNGG	1 cut(s)	288
BssMI	GATC	3 cut(s)	64, 345, 374
BssT1I	CCWWGG	1 cut(s)	288
Bst4CI	ACNGT	1 cut(s)	73
BstDSI	CCRYGG	1 cut(s)	288
BstF5I	GGATG	2 cut(s)	282, 284
BstKTI	GATC	3 cut(s)	67, 348, 377
BstMBI	GATC	3 cut(s)	64, 345, 374
BstV1I	GCAGC	2 cut(s)	30, 283
BstV2I	GAAGAC	1 cut(s)	192
Bsu15I	ATCGAT	1 cut(s)	351
BsuTUI	ATCGAT	1 cut(s)	351
BtgI	CCRYGG	1 cut(s)	288
BtsCI	GGATG	2 cut(s)	282, 284
BtsIMutI	CAGTG	2 cut(s)	78, 197
BveI	ACCTGC	1 cut(s)	374
CciI	TCATGA	1 cut(s)	16
Cfr13I	GGNCC	2 cut(s)	240, 364
ClaI	ATCGAT	1 cut(s)	351
CviAII	CATG	3 cut(s)	17, 289, 410
CviJI	RGCY	6 cut(s)	43, 88, 139, 212, 236, 371
CviKI_1	RGCY	6 cut(s)	43, 88, 139, 212, 236, 371
DpnI	GATC	3 cut(s)	66, 347, 376
DpnII	GATC	3 cut(s)	64, 345, 374
Eco130I	CCWWGG	1 cut(s)	288
Eco32I	GATATC	1 cut(s)	415
Eco47I	GGWCC	2 cut(s)	240, 364
EcoRV	GATATC	1 cut(s)	415
EcoT14I	CCWWGG	1 cut(s)	288
ErhI	CCWWGG	1 cut(s)	288
FaeI	CATG	3 cut(s)	20, 292, 413
FaiI	YATR	4 cut(s)	18, 290, 411, 440
FatI	CATG	3 cut(s)	16, 288, 409
Fnu4HI	GCNGC	2 cut(s)	44, 272
FokI	GGATG	2 cut(s)	271, 289
Fsp4HI	GCNGC	2 cut(s)	44, 272
FspBI	CTAG	4 cut(s)	147, 237, 266, 372
GluI	GCNGC	2 cut(s)	44, 272
Hin1II	CATG	3 cut(s)	20, 292, 413
HincII	GTYRAC	1 cut(s)	200
HindII	GTYRAC	1 cut(s)	200
HinfI	GANTC	2 cut(s)	311, 320
HphI	GGTGA	2 cut(s)	49, 398
Hpy166II	GTNNAC	2 cut(s)	177, 200
Hpy188I	TCNGA	3 cut(s)	69, 316, 345
Hpy188III	TCNNGA	3 cut(s)	17, 147, 253
Hpy8I	GTNNAC	2 cut(s)	177, 200
Hpy99I	CGWCG	2 cut(s)	28, 254
HpyAV	CCTTC	1 cut(s)	355
HpyCH4III	ACNGT	1 cut(s)	73
HpyCH4IV	ACGT	1 cut(s)	422
HpyCH4V	TGCA	3 cut(s)	125, 271, 409
HpySE526I	ACGT	1 cut(s)	422
Hsp92II	CATG	3 cut(s)	20, 292, 413
Kzo9I	GATC	3 cut(s)	64, 345, 374
LpnPI	CCDG	5 cut(s)	70, 125, 203, 203, 369
Lsp1109I	GCAGC	2 cut(s)	30, 283
LweI	GCATC	2 cut(s)	22, 293
MaeI	CTAG	4 cut(s)	147, 237, 266, 372
MaeII	ACGT	1 cut(s)	422
MaeIII	GTNAC	1 cut(s)	423
MalI	GATC	3 cut(s)	66, 347, 376
MboI	GATC	3 cut(s)	64, 345, 374
MboII	GAAGA	1 cut(s)	197
MluCI	AATT	2 cut(s)	150, 159
MnlI	CCTC	3 cut(s)	22, 33, 274
MseI	TTAA	1 cut(s)	153
MspA1I	CMGCKG	1 cut(s)	274
NcoI	CCATGG	1 cut(s)	288
NdeII	GATC	3 cut(s)	64, 345, 374
NlaIII	CATG	3 cut(s)	20, 292, 413
PagI	TCATGA	1 cut(s)	16
PaqCI	CACCTGC	1 cut(s)	374
PfeI	GAWTC	2 cut(s)	311, 320
PkrI	GCNGC	2 cut(s)	45, 273
PspPI	GGNCC	2 cut(s)	240, 364
SaqAI	TTAA	1 cut(s)	153
SatI	GCNGC	2 cut(s)	44, 272
Sau3AI	GATC	3 cut(s)	64, 345, 374
Sau96I	GGNCC	2 cut(s)	240, 364
SetI	ASST	5 cut(s)	141, 366, 373, 388, 425
SfaNI	GCATC	2 cut(s)	22, 293
SinI	GGWCC	2 cut(s)	240, 364
Sse9I	AATT	2 cut(s)	150, 159
SsiI	CCGC	1 cut(s)	274
SspMI	CTAG	4 cut(s)	147, 237, 266, 372
StyI	CCWWGG	1 cut(s)	288
TaaI	ACNGT	1 cut(s)	73
TaiI	ACGT	1 cut(s)	425
TaqI	TCGA	2 cut(s)	90, 351
TasI	AATT	2 cut(s)	150, 159
TfiI	GAWTC	2 cut(s)	311, 320
Tru1I	TTAA	1 cut(s)	153
Tru9I	TTAA	1 cut(s)	153
TscAI	CASTG	2 cut(s)	78, 197
TseI	GCWGC	2 cut(s)	43, 271
TspDTI	ATGAA	3 cut(s)	33, 149, 405
TspGWI	ACGGA	1 cut(s)	41
TspRI	CASTG	2 cut(s)	78, 197
VpaK11BI	GGWCC	2 cut(s)	240, 364
XapI	RAATTY	1 cut(s)	159
XbaI	TCTAGA	1 cut(s)	146
XspI	CTAG	4 cut(s)	147, 237, 266, 372

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.