RchiOBHm_Chr7g0232701

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
56896534 .. 56897120
587 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20858

Sequence Viewer

Length: 132 bp
ATGCCCACCCTTCTCAATGAGATTTGGAACCCCAACCCCAATCTCAAATGCCCACTCTTCTCTTTGAAAGGACTGATGCCTCAGGCTAGTTACGTACCCCGTTGTATGGAATCTAACACCTTCGGGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

4.87

Weight (kDa)

7.8

Isoelectric Point (pI)

52.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 96
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 1 cut(s) 67
AxyI CCTNAGG 1 cut(s) 81
BfaI CTAG 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 29
BmsI GCATC 1 cut(s) 66
BsaAI YACGTR 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 106
Bse21I CCTNAGG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 106
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 62
BstBAI YACGTR 1 cut(s) 94
BstDEI CTNAG 1 cut(s) 81
BstSNI TACGTA 1 cut(s) 94
Bsu36I CCTNAGG 1 cut(s) 81
Csp6I GTAC 1 cut(s) 95
CviJI RGCY 1 cut(s) 86
CviKI_1 RGCY 1 cut(s) 86
CviQI GTAC 1 cut(s) 95
DdeI CTNAG 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
Eco105I TACGTA 1 cut(s) 94
Eco81I CCTNAGG 1 cut(s) 81
FaiI YATR 2 cut(s) 107, 130
FspBI CTAG 1 cut(s) 87
HinfI GANTC 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 124
HpyAV CCTTC 2 cut(s) 20, 130
HpyCH4IV ACGT 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 93
LpnPI CCDG 1 cut(s) 68
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 87
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 89
MboII GAAGA 1 cut(s) 49
MnlI CCTC 1 cut(s) 90
NlaIV GGNNCC 1 cut(s) 29
PfeI GAWTC 1 cut(s) 110
Ppu21I YACGTR 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 29
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
SetI ASST 2 cut(s) 96, 122
SfaNI GCATC 1 cut(s) 66
SgeI CNNG 3 cut(s) 95, 99, 111
SnaBI TACGTA 1 cut(s) 94
SspMI CTAG 1 cut(s) 87
TaiI ACGT 1 cut(s) 96
TfiI GAWTC 1 cut(s) 110
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.